ID: 953627944

View in Genome Browser
Species Human (GRCh38)
Location 3:44586135-44586157
Sequence CTGAACTCAAGGAGGAGATC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 206}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953627941_953627944 -4 Left 953627941 3:44586116-44586138 CCTCTTAGGAACTTCTTCACTGA 0: 1
1: 0
2: 0
3: 9
4: 169
Right 953627944 3:44586135-44586157 CTGAACTCAAGGAGGAGATCAGG 0: 1
1: 0
2: 1
3: 19
4: 206
953627940_953627944 -3 Left 953627940 3:44586115-44586137 CCCTCTTAGGAACTTCTTCACTG 0: 1
1: 0
2: 0
3: 23
4: 192
Right 953627944 3:44586135-44586157 CTGAACTCAAGGAGGAGATCAGG 0: 1
1: 0
2: 1
3: 19
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953627944 Original CRISPR CTGAACTCAAGGAGGAGATC AGG Exonic
901758099 1:11453617-11453639 CTGCACACAAGGAGGGGAGCTGG + Intergenic
904307524 1:29599725-29599747 CTGGACTCAATTGGGAGATCTGG + Intergenic
905166720 1:36087455-36087477 CTGAGCTGCAGGAGGACATCCGG + Exonic
912543895 1:110437278-110437300 CTGAAATCAAAGATGAGCTCAGG + Intergenic
913320704 1:117586627-117586649 CTGAAGTCAAGGAGAGGATTGGG + Intergenic
913455530 1:119026809-119026831 CTGCACTGAAGGAGGAGGTGAGG - Intergenic
916712880 1:167427507-167427529 CTGCACTCCAGGAGGAGCTATGG + Intergenic
916843919 1:168629027-168629049 CTGAATTCAAGGGGGAGGTCTGG + Intergenic
917116559 1:171609299-171609321 CTAGTCTCAAGGAGGAGATAGGG - Intergenic
919265485 1:195259026-195259048 CTAAACTCAAGGAGGTGGGCAGG - Intergenic
919893390 1:201992545-201992567 ATGAGCTCAAGGAGGAGACATGG - Intronic
920708065 1:208269293-208269315 CTGAATTCATGGAGGAGAGAAGG + Intergenic
920968392 1:210721138-210721160 CTGAGCTGAAGCAGGAGGTCTGG - Intronic
921134882 1:212251221-212251243 CTGAGCTCAAGAAAGAGGTCTGG + Intergenic
921137388 1:212273741-212273763 CTGTACTGAAGGTAGAGATCTGG - Intergenic
921505174 1:215959036-215959058 CTGGCTCCAAGGAGGAGATCCGG - Intronic
921988189 1:221335129-221335151 CTGAACCCAAGTAGGAAAGCAGG + Intergenic
922101941 1:222484186-222484208 CTGAACTCCAGGAGGAGGAGGGG + Intergenic
922263021 1:223959308-223959330 CTGAACTCCAGGAGGAGGAGGGG + Intergenic
924344859 1:243064309-243064331 CTGAACTCCAGGAGGAGGAGGGG + Intergenic
924381865 1:243472732-243472754 CTGAACTCCAGCAGGAGAACAGG + Intronic
1064301522 10:14127168-14127190 CTGAAATCAGGGAGGAAATTAGG + Intronic
1066263893 10:33756197-33756219 ATGAGCTCAAGGAGAAGTTCAGG - Intergenic
1066503205 10:36014902-36014924 TTGAACTCACCGAGTAGATCAGG + Intergenic
1067166376 10:43869253-43869275 CTGAAGCCATGGAGGAGACCGGG - Intergenic
1067197259 10:44132756-44132778 CTCATCTCAGGAAGGAGATCTGG + Intergenic
1068587995 10:58821768-58821790 CTGGATTCAATTAGGAGATCTGG + Intronic
1070484017 10:76912568-76912590 CTGAACACAAGGAAGAAATCTGG + Intronic
1070509513 10:77147660-77147682 CTGAACTCAAAGAAGAGAACTGG + Intronic
1070890531 10:79939825-79939847 CTGAACTCAAAGCTGATATCAGG + Intronic
1073559459 10:104484471-104484493 CTGGTCTCAAGAAGGGGATCAGG - Intergenic
1076124841 10:127965920-127965942 CTGAAGGCCAGGAGGAGGTCAGG - Intronic
1076753245 10:132554295-132554317 CTGAGCTCCAGCAGGAGATGAGG + Intronic
1078866416 11:15302214-15302236 CAGAAGTCTAGAAGGAGATCTGG + Intergenic
1080693426 11:34579619-34579641 GTGAACTCCAGGATGAGATTGGG - Intergenic
1080838986 11:35966993-35967015 CTGAACTAAAGGAAGAAAACAGG - Intronic
1084570264 11:69955507-69955529 CTGAAGACCAGGAGGAGAGCCGG + Intergenic
1084751393 11:71206292-71206314 CTAAACGCACAGAGGAGATCCGG - Intronic
1084974792 11:72790813-72790835 CAGAACTGGAGGAGGAGATGGGG + Intronic
1085764146 11:79268144-79268166 GTGAACTCAAAGAGAAAATCTGG + Intronic
1086151081 11:83611772-83611794 CTGAACTGAAGGACGGGAACAGG + Intronic
1088692623 11:112340876-112340898 CTACATTCAAGGAGGGGATCTGG - Intergenic
1089602829 11:119625793-119625815 CTGAGCTCGAGGAGGAGGACTGG + Intronic
1091117702 11:133030062-133030084 CTCAACACAAGGAGTGGATCTGG + Intronic
1092959518 12:13582697-13582719 CTGAACTCAACGTGGAGCTGGGG + Intronic
1099656285 12:85496284-85496306 CTGAACTCAAGGTGTCAATCAGG + Intergenic
1100330754 12:93579766-93579788 CTGAAGTCATGGAGCAGAGCTGG + Intronic
1101684750 12:107007909-107007931 CTGAACTCAAGAAGGAAAAGGGG - Intronic
1104491901 12:129201474-129201496 ATGAACTCAATGAGGAGTTTGGG - Intronic
1107751407 13:43571339-43571361 GTGAACTCAAGGTGGGAATCGGG + Intronic
1111800786 13:92977921-92977943 CTCCTCCCAAGGAGGAGATCTGG + Intergenic
1112922812 13:104636382-104636404 CTGAGCTCAAGGCTGAGAACCGG - Intergenic
1115119651 14:29925624-29925646 CTGAACTCCAGGAGGAAGTGGGG + Intronic
1116019250 14:39441313-39441335 ATGAACTCAAGAGGGAGACCGGG + Intergenic
1117095354 14:52291657-52291679 CTGATCTCAAGGGGGGGCTCTGG + Intergenic
1117464247 14:55976281-55976303 CCAAACTCAAGGAGGAGGCCGGG - Intergenic
1117553152 14:56856381-56856403 CTGAACTCAATGAAAAGATGAGG + Intergenic
1122533538 14:102445783-102445805 CTGAAAATAAGGAGGAGAACAGG - Intronic
1202897026 14_GL000194v1_random:16237-16259 CTGAACTCAGGGTGGTCATCAGG + Intergenic
1123411740 15:20066537-20066559 CCAAAATCAAGGAGGAGAACTGG + Intergenic
1123521084 15:21073656-21073678 CCAAAATCAAGGAGGAGAACTGG + Intergenic
1124649481 15:31464451-31464473 CAGAACGGAAGGAGGAGTTCTGG - Intergenic
1125360496 15:38859718-38859740 CAGAACTTCAGGAGGAGATATGG - Intergenic
1128396624 15:67232599-67232621 CTGAACTCAAAGATGACATCTGG - Intronic
1128522116 15:68382356-68382378 GTGAACTCAGGCAGGAGACCAGG - Intronic
1129243026 15:74262676-74262698 CTGAGCCCAAGGAGGTGTTCAGG - Intronic
1131815487 15:96217250-96217272 CTGAACTCAAGAAGGAAAGTTGG + Intergenic
1133253423 16:4500540-4500562 CTGAACTGAAGGAAGAGAGCAGG - Intronic
1133304124 16:4799368-4799390 CAGAACTCAAGCATGAGGTCAGG + Intronic
1135745630 16:25014666-25014688 CTGAACTCACTGAGCAAATCCGG + Intronic
1136098813 16:27978239-27978261 CAGACCTACAGGAGGAGATCTGG - Intronic
1138911185 16:61401147-61401169 GTGTACTGAAGGAGAAGATCTGG + Intergenic
1144010546 17:11144478-11144500 CTGAACTCACTCAGGAGACCTGG - Intergenic
1144604282 17:16651089-16651111 ATTAACTCAAGGAGGAGACCAGG + Intronic
1144831009 17:18131216-18131238 CTGGACTCCAGAAGGAGATGTGG - Intronic
1146367993 17:32244474-32244496 CTGGCCTCAAGGAGGAGGGCTGG + Intronic
1148957900 17:51369276-51369298 GTGAAATCAAGGTGGAGATCAGG + Intergenic
1153891898 18:9524727-9524749 CGGGCATCAAGGAGGAGATCAGG + Exonic
1154181490 18:12143330-12143352 CAGAAGTGAACGAGGAGATCGGG - Intergenic
1154182414 18:12148254-12148276 CAGAAGTGAACGAGGAGATCGGG + Intergenic
1155571582 18:27200638-27200660 CTGAAATCAAGGTGTTGATCAGG + Intergenic
1156218378 18:35026288-35026310 TTTAGCTCAAGCAGGAGATCTGG + Intronic
1157020879 18:43780333-43780355 GTGAACTCATGGAGGAATTCAGG + Intergenic
1159057206 18:63477878-63477900 CAGAACTCACAGAGGTGATCTGG + Intronic
1160621989 18:80178240-80178262 CTGCACTCTAAGAGGAGAACAGG + Intronic
1162364255 19:10238312-10238334 CTGAGCCCATGGAGGAGATGAGG - Intergenic
1163929843 19:20378360-20378382 ATGAACACAAAGAGGAGAACAGG - Intergenic
1164021857 19:21314681-21314703 GTAAAAACAAGGAGGAGATCTGG - Intronic
1165925070 19:39321296-39321318 CTGAGGTCAAGCAGGAGAGCAGG - Intergenic
1166870406 19:45867102-45867124 CGGACCTCAAGGAGGACTTCCGG + Intronic
1166902916 19:46080020-46080042 CTGAACTCGAGGAAGGGATGTGG - Intergenic
1167422637 19:49413200-49413222 CTCAGGTCTAGGAGGAGATCTGG + Intronic
925270781 2:2605967-2605989 CTGAACTCAAAGATGAGCTTTGG - Intergenic
925425931 2:3748602-3748624 GTGAAGTCAAGGAAGAGATCAGG + Intronic
925989884 2:9246104-9246126 CTGAAGTCAAGCAGCTGATCAGG - Intronic
927721593 2:25386741-25386763 CTGAACACAAGGAGCAGAAGAGG + Intronic
928364532 2:30691124-30691146 CTGGACTAAAGGAGGTGTTCAGG - Intergenic
928396562 2:30947084-30947106 CTGAACTCAAAGAGCAGTTTTGG - Intronic
931050324 2:58406810-58406832 CTGGACACAAGGAGGAAAGCAGG - Intergenic
931208440 2:60169716-60169738 GTGGGCTCAAGGAGTAGATCTGG + Intergenic
932750757 2:74370180-74370202 ATGAGCTCAAGGAGCAGGTCTGG - Exonic
932955307 2:76344749-76344771 CTGAACTAAAGCAGCACATCTGG - Intergenic
934980262 2:98833643-98833665 CTGAACTCAAGAATCTGATCTGG + Intronic
935150046 2:100425888-100425910 CAGGCTTCAAGGAGGAGATCAGG + Intergenic
936540218 2:113343789-113343811 CAGAACTTGAGGAAGAGATCAGG - Intergenic
938157865 2:128956886-128956908 CTGAAAGCAAGGAGCAGATGGGG - Intergenic
938491286 2:131762550-131762572 CTGAACTCAGGGTGGTCATCAGG - Intronic
938496276 2:131799776-131799798 CTGAACTCAGGGTGGTCATCAGG + Intronic
940565680 2:155357095-155357117 CTGATCTCAAGGAGGGGAAGAGG - Intergenic
944805705 2:203278903-203278925 CTGAACTCTAGGAGGGTATCTGG - Intronic
944807234 2:203294597-203294619 CTGAATTCTAGGAGGGTATCTGG - Intronic
948888202 2:240894226-240894248 CTGACCTCACGGAGGACATGAGG + Intronic
1168858053 20:1023230-1023252 GTGAACTCAAGGATGAGGTTAGG + Intergenic
1170066839 20:12320284-12320306 CTGAAATTAAGGATGAGATGGGG + Intergenic
1172924490 20:38519661-38519683 CTGAACACAATGAGGAGAAAAGG - Intronic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1173054609 20:39598947-39598969 CTGAACTGAAAGAGCAGACCTGG + Intergenic
1173880115 20:46406015-46406037 CTGAACTCAAGGGTGAGCGCAGG + Intronic
1175147554 20:56908311-56908333 CTTAACTCAAGGTGGAGGCCGGG - Intergenic
1175483707 20:59329640-59329662 CTGAACTCAAGCCAGAGGTCAGG + Intergenic
1175965485 20:62658163-62658185 CAGAGCTCAAGGAGGACATGAGG - Intronic
1176708416 21:10131420-10131442 CTGAACTCAGGGTGGTCATCAGG - Intergenic
1177714467 21:24821372-24821394 CTGAACTAAAGGACTTGATCTGG - Intergenic
1182567357 22:31210348-31210370 GTGAACTCAAGGGGGACTTCTGG - Intergenic
1182618375 22:31603921-31603943 CTGAGCTGAAGGAGGAGAACAGG + Intronic
1183823130 22:40363186-40363208 ATGAACTGAAGGATGAGCTCGGG - Intronic
1184011212 22:41749985-41750007 CTGAAGACAAGGGAGAGATCTGG + Intronic
1184273891 22:43399608-43399630 CTGAACCCGGGGAGGAGACCTGG + Intergenic
1184920401 22:47601526-47601548 CTCAATTCAAGCAGGAGATGGGG - Intergenic
950457337 3:13100503-13100525 CGGAGCTCAAGGAGGTGTTCAGG - Intergenic
952496004 3:33916305-33916327 CTGACCTCAGGGAGTAGATTAGG - Intergenic
953627944 3:44586135-44586157 CTGAACTCAAGGAGGAGATCAGG + Exonic
954228729 3:49199835-49199857 CTCAACTCCAGGCGGGGATCTGG - Intronic
955157787 3:56434372-56434394 CTGTCCTCAAGGAGCAGATGAGG - Exonic
955204927 3:56887325-56887347 CAGAACTCAAGAAGGAAATGGGG - Intronic
955509470 3:59664940-59664962 TTGCCCTCAAGGAGGAGATGGGG + Intergenic
955900750 3:63751486-63751508 CTGAAGACAAGGAGGAGAAATGG - Intergenic
956333919 3:68142441-68142463 CAGAATTGAAGGAGGAGCTCTGG - Intronic
959270137 3:104196700-104196722 CAAAATTTAAGGAGGAGATCTGG + Intergenic
960753715 3:120984167-120984189 CTGAGCTGAAAGAGGAGAACTGG - Intronic
961627124 3:128271776-128271798 CTGGACTCAAGAAGAAGACCTGG - Intronic
961917185 3:130389216-130389238 CTGAAGTCCAGGTGGAGGTCAGG - Intronic
962263468 3:133929261-133929283 CTGCAGGCAAGGAGGAGATGGGG - Exonic
966474105 3:180324289-180324311 CAGGTATCAAGGAGGAGATCAGG + Intergenic
966759064 3:183399799-183399821 CTGATCTTCAGGAGGAGTTCAGG - Intronic
972508242 4:39741816-39741838 CTTAACCCAAAGAGGAGATGAGG - Intronic
975491061 4:74989336-74989358 TTGAACACAAGGAGGGGATATGG - Intronic
975491320 4:74991946-74991968 TTGAACACAAGGAGCAGGTCTGG - Intronic
976037499 4:80842049-80842071 CTACACTCAAGGAGGAGAAGCGG - Intronic
976823520 4:89234082-89234104 CTGAAATCAAGGAGACCATCAGG + Intergenic
977611956 4:99044984-99045006 CTGAACTCACTGTGGAGAGCAGG - Intronic
980158254 4:129132370-129132392 CTGGACTCAAGGTGTACATCAGG + Intergenic
981342609 4:143639342-143639364 CTGGACTGAGTGAGGAGATCTGG + Intronic
983641638 4:169948891-169948913 CTGAAATTAATGAGGAAATCTGG - Intergenic
986235901 5:5909897-5909919 CTGGAACCAAGCAGGAGATCAGG + Intergenic
987264175 5:16235195-16235217 CTGAAAGCAAGGAGGAGAAAGGG - Intergenic
988848905 5:35159138-35159160 CTGACCTCATGGAAGAGATCTGG + Intronic
989067491 5:37478961-37478983 AAGAACTAAAGGAGGAGATGAGG + Intronic
989311005 5:40018154-40018176 CTGAAACCAAGGAGGTGGTCAGG - Intergenic
991977155 5:72194738-72194760 CTGAAGTTAAGTAGGAAATCGGG - Exonic
995281653 5:110342329-110342351 CAAATCTCAAGGAGGGGATCAGG + Intronic
997176794 5:131786911-131786933 CTGAACTAAAGCAGGGGATGTGG + Intronic
1002912244 6:1499070-1499092 CTGAACCCAAGGTGGAGGTCTGG - Intergenic
1005860729 6:29897809-29897831 CTGAAGTGAAGGAGGAGTTGGGG + Intergenic
1007294451 6:40811342-40811364 CTACACTCCAGGAGGAGATGGGG + Intergenic
1008532967 6:52481616-52481638 CTGAACTCAAGGAGGATCTCAGG - Intronic
1008686037 6:53927349-53927371 CTGAACACAAGGAACAGATCAGG - Intergenic
1010516857 6:76784042-76784064 CTGGAATCAAGGAGATGATCTGG - Intergenic
1013233480 6:108176566-108176588 GTGGACACAAGGAGGAGAACGGG + Exonic
1016811279 6:148263420-148263442 CTGAACTCAAGGTGGTGTTCTGG - Intergenic
1017522096 6:155211515-155211537 CAGAAGTCATGGAGGAGTTCTGG - Intronic
1017786182 6:157758943-157758965 CTGAACTGAAGGCAGGGATCTGG + Intronic
1021959863 7:25860473-25860495 CTGAACCGAAGGAGGAGTGCCGG + Intergenic
1022704455 7:32789550-32789572 CAGGAGTTAAGGAGGAGATCGGG + Intergenic
1022947919 7:35306151-35306173 CTTGACTCAAGGAAGTGATCTGG - Intergenic
1023080757 7:36524035-36524057 CTGAAGTCACGGAGGGGATGGGG - Intronic
1024371469 7:48588856-48588878 CTGACATCAAGGAGGGAATCAGG + Intronic
1026182937 7:68058116-68058138 GAGAACTCAAGTAGGAGAGCAGG + Intergenic
1029011610 7:97268004-97268026 GTGTACTCAAGGAGGAAATGTGG + Intergenic
1030015170 7:105211949-105211971 CAGAACTCAGTGAGGTGATCAGG - Intronic
1030304808 7:108006775-108006797 CTTAGCTCAAGACGGAGATCTGG + Intergenic
1031020382 7:116621128-116621150 CTAAACTCAGGCAGGAGCTCTGG - Intergenic
1031571952 7:123370045-123370067 CTGTACTGAAGCAGGAGATGAGG - Intergenic
1033385373 7:140869184-140869206 CTGAAATCAAGTAAGAGATGTGG + Intronic
1035040549 7:155923773-155923795 CTCATCTCCAGGAGGAGCTCAGG - Intergenic
1035838781 8:2788087-2788109 CTGAACCCAAAGATGAGAACAGG - Intergenic
1036601919 8:10268842-10268864 CTGAATTCCAGGAGGATAACAGG - Intronic
1037839736 8:22235551-22235573 CTGAACTCAGTGTGGGGATCCGG + Intergenic
1038660277 8:29491204-29491226 TCAAACCCAAGGAGGAGATCAGG - Intergenic
1038922260 8:32097911-32097933 TGGAACTCAAGGAAGAGGTCAGG + Intronic
1040629950 8:49198835-49198857 CTGAACATAAGGAGGGGCTCCGG + Intergenic
1042379340 8:68094928-68094950 CTGAACCCAAGGAAGGGATGTGG - Intronic
1043971357 8:86532493-86532515 CTGAAATCTATGAGTAGATCAGG - Exonic
1045575027 8:103411279-103411301 CTGAAATCAAGGAAGAAATTGGG - Intronic
1046796055 8:118373384-118373406 CTGAACTGAAGTAGGCCATCTGG - Intronic
1047239522 8:123073212-123073234 CAGAACTCCAGGAGGAGATGCGG + Intronic
1048266209 8:132989552-132989574 CTGAGCTCCAGGATGAGGTCAGG - Intronic
1048946413 8:139452519-139452541 CTTGACTCAAGGACCAGATCAGG - Intergenic
1050768235 9:9163203-9163225 CTGTACTGAAGGAAGAGATTTGG - Intronic
1050842730 9:10172639-10172661 CTGAACTGAATTAGGAGAACAGG + Intronic
1053418966 9:37964899-37964921 CGGAACTCAGGAAGGAGCTCAGG - Intronic
1053645381 9:40116933-40116955 CTGAACTCAGGGTGGTCATCAGG - Intergenic
1053760333 9:41346594-41346616 CTGAACTCAGGGCGGTCATCAGG + Intergenic
1054326402 9:63714834-63714856 CTGAACTCAGGGTGGTCATCAGG - Intergenic
1054539192 9:66259039-66259061 CTGAACTCAGGGTGGTCATCAGG + Intergenic
1055798284 9:80000625-80000647 CTGAATTTAAGAAGGAGATCTGG - Intergenic
1055806082 9:80095306-80095328 CTGCACTCCAGGAGTAGCTCTGG - Intergenic
1056013789 9:82360564-82360586 CTGAACACCAGGATGAGATGGGG - Intergenic
1056902694 9:90614487-90614509 CTGGAAACAAGGAAGAGATCGGG + Intronic
1057425995 9:94950310-94950332 CTGAATGCCAGGAGGAGCTCTGG + Intronic
1058189056 9:101891081-101891103 CTGAACTCAAGCAAGTGTTCGGG - Intergenic
1058784667 9:108375138-108375160 CTGGACTCAAGCTGGAGATCGGG + Intergenic
1058838106 9:108877630-108877652 CAGAACTCAGGGATGGGATCAGG - Intronic
1060070895 9:120546533-120546555 ATGAACTCAAGTAGTAGATGGGG + Intronic
1060219577 9:121757229-121757251 CTGGACTCCAGGAGGATGTCTGG - Intronic
1060947335 9:127577648-127577670 CTGAACTCTAGGATTGGATCTGG - Intronic
1061070166 9:128304972-128304994 ATGAGCACAGGGAGGAGATCTGG - Intergenic
1202793177 9_KI270719v1_random:100389-100411 CTGAACTCAGGGTGGTCATCAGG - Intergenic
1186001728 X:5020132-5020154 CTGAACTCAAGAAAAAGATGGGG - Intergenic
1189130132 X:38489985-38490007 ATGATCTCAAGGTGGAGCTCTGG + Intronic
1189293583 X:39903111-39903133 CAGAACTCAAAGAGGATAGCCGG - Intergenic
1189775693 X:44468609-44468631 ATGAAATCAAGGAGGTGCTCTGG + Intergenic
1193928599 X:87523388-87523410 CCGAAATCAAGGAGGAGCACTGG + Intronic
1194372860 X:93095863-93095885 CTGAACTCCAGGAGGGGATTAGG + Intergenic
1200680899 Y:6209903-6209925 CTGAACTCCATGAGGGGATTAGG + Intergenic
1201150116 Y:11091077-11091099 CTGAACTCAGGGTGGTCATCAGG + Intergenic
1201620647 Y:15953336-15953358 CTGAGATCAAGGAGTAGATAGGG - Intergenic