ID: 953628372

View in Genome Browser
Species Human (GRCh38)
Location 3:44589706-44589728
Sequence GGATATAAACTGATGGTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953628372_953628376 13 Left 953628372 3:44589706-44589728 CCTTTGACCATCAGTTTATATCC 0: 1
1: 0
2: 1
3: 10
4: 139
Right 953628376 3:44589742-44589764 TGTAATTTCAGTATTCTGGTTGG 0: 1
1: 1
2: 17
3: 420
4: 7614
953628372_953628375 9 Left 953628372 3:44589706-44589728 CCTTTGACCATCAGTTTATATCC 0: 1
1: 0
2: 1
3: 10
4: 139
Right 953628375 3:44589738-44589760 ATCTTGTAATTTCAGTATTCTGG 0: 1
1: 0
2: 0
3: 24
4: 340
953628372_953628377 25 Left 953628372 3:44589706-44589728 CCTTTGACCATCAGTTTATATCC 0: 1
1: 0
2: 1
3: 10
4: 139
Right 953628377 3:44589754-44589776 ATTCTGGTTGGAATCACTTCAGG 0: 1
1: 0
2: 1
3: 12
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953628372 Original CRISPR GGATATAAACTGATGGTCAA AGG (reversed) Intronic
903608515 1:24592518-24592540 GAATACACACTAATGGTCAAGGG + Intronic
904220378 1:28962759-28962781 GGACCTAAACTGAGGGGCAATGG - Intronic
907250863 1:53138227-53138249 GGAGATAAACTGATGATCTTTGG - Intronic
907640358 1:56182956-56182978 GGGTATGAACTGTTGGTTAATGG + Intergenic
907719754 1:56960718-56960740 GGATAGAAAGTGATGGTGGATGG + Intronic
910103934 1:83610263-83610285 GCATATAAAGTAATGTTCAAAGG - Intergenic
911663278 1:100527399-100527421 GGATATTAACTGATAGACGAGGG - Intergenic
913137970 1:115911123-115911145 CTATATAAACTGATGGAAAAAGG - Intergenic
917936754 1:179875564-179875586 TGATAGATACTCATGGTCAAGGG + Intronic
918449207 1:184642719-184642741 GGAGATAAGCTGATGGTAGAAGG - Intergenic
921666140 1:217874074-217874096 AGATATAAACTGGAGTTCAAGGG + Intergenic
922384211 1:225065498-225065520 GGAAATGGAATGATGGTCAAAGG - Intronic
923158190 1:231296633-231296655 GGTTATAAACAGGTGGTTAAAGG - Intergenic
924812136 1:247412457-247412479 GGAAATAAAATGACGGTCAAAGG - Intergenic
1062869792 10:890247-890269 TGAAATAATCTGATGATCAAAGG + Intronic
1066376134 10:34859005-34859027 GGATATAAAAAGATGAACAAGGG - Intergenic
1067572701 10:47383685-47383707 GGATATAATCTGTTGGAGAAAGG + Intronic
1070705758 10:78636823-78636845 GGATATAACCTCATGTTCATGGG + Intergenic
1071841962 10:89481352-89481374 GGATGTGAACTGATGTTAAATGG - Intronic
1074222953 10:111456128-111456150 GCATGTAAACAGATGGTAAATGG - Intergenic
1077992558 11:7424986-7425008 GGGTATAAACTTAGAGTCAAAGG + Intronic
1079455946 11:20636426-20636448 GGATAGAGACTGATGGAAAAGGG - Intronic
1080101003 11:28459336-28459358 GAAGATAAACTGATGCCCAATGG + Intergenic
1081758295 11:45559991-45560013 GGAAATTAACTAGTGGTCAATGG + Intergenic
1088939694 11:114440236-114440258 TCATATAAACTGAGGCTCAACGG - Intronic
1090823965 11:130370515-130370537 CCATATAAACTTCTGGTCAAGGG + Intergenic
1091024282 11:132128054-132128076 AAATGTAAACTGATGGTCACAGG - Intronic
1093315690 12:17647225-17647247 GGATAGAAAGAAATGGTCAAAGG + Intergenic
1093921443 12:24864251-24864273 GGATATAACCACAAGGTCAAAGG - Intronic
1097581455 12:61462188-61462210 TCATATAAACTGAAGGTAAAGGG + Intergenic
1098926686 12:76359076-76359098 GGATATAAACTAATAGTGATGGG - Intronic
1104352100 12:128053745-128053767 GGCTAGAAATTGATGCTCAAAGG + Intergenic
1108902572 13:55430780-55430802 GGGTATAAAATGATGCTGAAGGG + Intergenic
1110064876 13:71091118-71091140 GGAGAGAAACAGATGGTGAAAGG + Intergenic
1110251040 13:73380889-73380911 GGATATAAACTGATATTCAAAGG - Intergenic
1111974845 13:94955060-94955082 GGAAACAAACTGATGATGAATGG + Intergenic
1115011729 14:28556279-28556301 GGACATAAACTGATGCAGAAAGG + Intergenic
1116483430 14:45418531-45418553 GGAGATAAACTGGTAGTAAATGG + Intergenic
1116909246 14:50441156-50441178 GGCTATCAACAGATTGTCAATGG + Intronic
1118041770 14:61924842-61924864 AGAAATAAACTAATGGTTAAAGG - Intergenic
1118433506 14:65747222-65747244 GGTTATAAACTAATGGGCCATGG - Intergenic
1118444609 14:65839966-65839988 GGAAATCCTCTGATGGTCAAGGG - Intergenic
1119973936 14:79004123-79004145 AGATTTAAACTGATTGCCAAGGG + Intronic
1126779930 15:52130747-52130769 AGTTGAAAACTGATGGTCAAAGG + Intronic
1127573763 15:60270529-60270551 TCATATAAACTTATGGTAAAGGG - Intergenic
1130302831 15:82693101-82693123 GGTTAAAAACAGAAGGTCAAAGG + Intronic
1131217235 15:90548331-90548353 GGGAACAATCTGATGGTCAAGGG + Intronic
1131650974 15:94399427-94399449 GGGAATAAACTGAGGGTCAGAGG - Intronic
1135718416 16:24793175-24793197 GGAATTAAACTGATGCTCAAAGG + Intronic
1137421630 16:48339897-48339919 GGATAAGAAATGATGGTCAGGGG + Intronic
1137907643 16:52339790-52339812 TTATATAAACTGATGTTCATTGG - Intergenic
1139820761 16:69719404-69719426 AGATATAACCTGATTGTCTATGG + Intronic
1140306619 16:73808862-73808884 GGATAGAAACTGCTGGAAAAAGG + Intergenic
1141244741 16:82295237-82295259 GCATCTAAACTGATGGAAAATGG + Intergenic
1141359141 16:83378387-83378409 TGTTAAAAACTCATGGTCAAGGG - Intronic
1143279646 17:5743304-5743326 AAATAAAAAGTGATGGTCAAGGG + Intergenic
1143981506 17:10874072-10874094 GAACATAAACTGGTGGACAAAGG + Intergenic
1149838735 17:59938817-59938839 GGAGATACACTGATTGTCACAGG + Intronic
1151121940 17:71802446-71802468 GGAACTAAAATGTTGGTCAACGG - Intergenic
1154279868 18:12993068-12993090 GAATAAAAAGTGATGGGCAACGG + Intronic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
1167910862 19:52700706-52700728 TGATACAGACTGATGGACAAGGG + Intergenic
926584695 2:14673338-14673360 GGCTAAAAACAGATGGTCACGGG - Intergenic
929727444 2:44445399-44445421 GGATACAAACTGAAGATGAATGG - Intronic
930599426 2:53426021-53426043 GTATATAAACTGATAGGCAAAGG - Intergenic
930784033 2:55253055-55253077 GGATTTAAACCCAAGGTCAATGG - Intronic
931585166 2:63818255-63818277 GGATCTAAGCTGATGGTCTAGGG + Intronic
933526442 2:83446440-83446462 GGATAGAACATGAAGGTCAATGG - Intergenic
936740743 2:115504327-115504349 GGATAAAAACTGATGGCTACTGG + Intronic
940516523 2:154690819-154690841 GGATATAAACTTTTGTTCATGGG - Intergenic
942757143 2:179355097-179355119 GGATATCAAGTGATTTTCAAGGG + Intergenic
943199002 2:184794780-184794802 GCATATAAACTTAAGGTAAAGGG + Intronic
944454908 2:199883365-199883387 GGATCTAAAGGGCTGGTCAAGGG + Intergenic
945569310 2:211445075-211445097 GGATCTAAATTAATTGTCAATGG + Intronic
947439945 2:230110492-230110514 GGATATATAGTCATAGTCAATGG + Intergenic
947812317 2:233012194-233012216 AGAAATACACTGATAGTCAATGG + Intronic
1170498337 20:16948675-16948697 GGTTAAAAACTGATGCTCAAGGG - Intergenic
1172748740 20:37234331-37234353 GGTTATTAACTGAGGGTAAATGG - Intronic
1173034150 20:39392616-39392638 GGATAAAATCTGATGATGAAAGG - Intergenic
1175568396 20:59999318-59999340 CCATGTAAACTGATGGTAAAAGG - Intronic
1181485111 22:23225609-23225631 GGATATAAACTAGAGGTAAAGGG - Intronic
949373769 3:3364371-3364393 GGCTATAAACTGATGGGCGTGGG - Intergenic
953628372 3:44589706-44589728 GGATATAAACTGATGGTCAAAGG - Intronic
955288400 3:57667555-57667577 CTATATAAGCTGAGGGTCAAGGG - Intronic
955932658 3:64073240-64073262 GGATGCAAACTGAAGGTGAATGG + Intergenic
958132593 3:89447889-89447911 GGATTTGAAGTGATGCTCAAGGG - Intronic
959269143 3:104183481-104183503 AGAAAAAAACTGAAGGTCAAAGG + Intergenic
962061634 3:131933895-131933917 GGAAATAAGATGTTGGTCAAAGG + Intronic
964344410 3:155741660-155741682 GGATATAAAATTATGATAAAAGG - Intronic
967380643 3:188853685-188853707 GCATATAAACTGATCGTCTTTGG + Intronic
970984168 4:22136351-22136373 GGATATAAAGTGTGGGTAAATGG - Intergenic
972552430 4:40146790-40146812 GGAAATGAAATGCTGGTCAAAGG - Intronic
973834257 4:54793299-54793321 GGATATAAAGTAATGGTACATGG - Intergenic
973964292 4:56145463-56145485 AGATATTAACAGATGGTCTATGG - Intergenic
978454994 4:108879419-108879441 TGAAATAAACTGATGGTATATGG + Intronic
979693417 4:123584626-123584648 GGATATAAACTGAACCTTAAAGG - Intergenic
980233389 4:130072697-130072719 GGAAATAAAATGAGGGTCTAGGG - Intergenic
980455411 4:133034319-133034341 GGATAAAGTGTGATGGTCAAAGG + Intergenic
980678726 4:136126513-136126535 GGATATAAAGTCATGGTCTTGGG - Intergenic
983780539 4:171665363-171665385 AGAGATAAGCTGAGGGTCAAAGG + Intergenic
984175796 4:176415264-176415286 GAAAATAAACTTATGGTGAAAGG - Intergenic
984405739 4:179327511-179327533 GGACAGAAACTGATGGTAACTGG + Intergenic
984718120 4:182944356-182944378 GGATATCACCTGCTGATCAAGGG - Intergenic
985447770 4:190036216-190036238 AGAAAGACACTGATGGTCAATGG + Intergenic
988394856 5:30683719-30683741 CAATATAAACAGGTGGTCAATGG + Intergenic
991299433 5:65114636-65114658 GGTTATAAACTGAATTTCAAGGG + Intergenic
992290513 5:75274822-75274844 GGATTTTAACTGATGGTGAGGGG - Intergenic
993999195 5:94757911-94757933 GGATATCAAATGGTGGTCAAGGG + Intronic
994562503 5:101394352-101394374 TGAAATAAACTGATAGTAAACGG + Intergenic
995848223 5:116517350-116517372 GGATATAAAGTGATGGAGAAAGG + Intronic
996108387 5:119534625-119534647 GGATATAAACTAAATCTCAAGGG + Intronic
997733209 5:136195247-136195269 GGCTATAAAATGAGGGGCAATGG + Intergenic
1001377010 5:171269543-171269565 TGATGTAAACAGATGATCAATGG - Intronic
1003932321 6:10936721-10936743 AGATATAAACTGAAAGTGAAGGG + Intronic
1008188609 6:48426240-48426262 GGATATAAACTCATAATCAAAGG - Intergenic
1011123246 6:83978047-83978069 GTTTATAAACTGGTGGCCAATGG - Intergenic
1012853755 6:104476753-104476775 GGAAATAAACTGATGGTCTGTGG - Intergenic
1012930700 6:105313277-105313299 GGAGTTACACTGATGGTCGACGG - Intronic
1016539551 6:145149071-145149093 GAAAATAAACTGAGTGTCAATGG + Intergenic
1016792567 6:148080723-148080745 AGAGATAAAATGATGGTGAAAGG - Intergenic
1017617528 6:156260894-156260916 GCAAAGAAACTGATGTTCAAAGG - Intergenic
1018252761 6:161888694-161888716 GGGTATGAAGTGATGATCAAAGG - Intronic
1018752071 6:166815570-166815592 GGAAATAATCTGATGTGCAAAGG + Intronic
1019087018 6:169488038-169488060 GCATATGAAATGATGGACAATGG + Intronic
1019959146 7:4443326-4443348 GGATAAAAAATGTTGGTGAAGGG - Intergenic
1022277976 7:28875151-28875173 GGGTACAAACTTTTGGTCAAAGG - Intergenic
1022450759 7:30512557-30512579 GAATATAATCTGATTTTCAAAGG + Intronic
1022787226 7:33650672-33650694 AGTCATACACTGATGGTCAAGGG - Intergenic
1030626238 7:111848909-111848931 GCAGATAAAGGGATGGTCAATGG - Intronic
1032277377 7:130470967-130470989 AGATATTAACTAATGGTCCAAGG + Intergenic
1033530591 7:142258973-142258995 GAATATATACAGATGGTAAATGG + Intergenic
1037670226 8:21008975-21008997 GGATATAAAAGGATGGTATAGGG + Intergenic
1037797538 8:22009308-22009330 GGATACAAACTAATGGACAGTGG + Intergenic
1038028589 8:23616020-23616042 TGATATAAATTGATTTTCAAAGG + Intergenic
1045867922 8:106890371-106890393 GGATTCAAAATGATGGTCTAGGG + Intergenic
1047181520 8:122593385-122593407 GGATAGAAATTGATGCTCAGTGG - Intergenic
1047812102 8:128422100-128422122 GCATTTAAACTGATGGTGGAAGG + Intergenic
1051997804 9:23239288-23239310 GGATAAAAAGAGATGGGCAAAGG + Intergenic
1055673005 9:78626106-78626128 GTATATACACAGATGGTCATTGG - Intergenic
1059267932 9:113053151-113053173 GGATAGGAAATGATGGTCAGAGG - Intronic
1186359413 X:8824165-8824187 CAAGATAACCTGATGGTCAATGG - Intergenic
1189665372 X:43349781-43349803 GTATATGAACTGAAGGTCATGGG - Intergenic
1194192609 X:90856199-90856221 ACATATAGACTGATGGTAAAGGG - Intergenic
1194441109 X:93935536-93935558 GGATAAAAAGAGATGGTTAATGG + Intergenic
1194811957 X:98398324-98398346 GGGTACTAACTGATGGTAAAGGG - Intergenic
1195625420 X:107001516-107001538 GGGTAAAAAATGATGCTCAAAGG - Intergenic
1196001779 X:110794908-110794930 GGATTTCAGCTGATGGACAAGGG - Intronic
1197186686 X:123595240-123595262 CAAAATAAACTGATGGTGAAGGG - Intergenic
1197690730 X:129498134-129498156 GAATCTAATCTGATGGCCAAAGG - Intronic
1198458475 X:136840599-136840621 GGATAAAAAGTGATGGTTAATGG - Intergenic
1200539238 Y:4438644-4438666 ACATATAGACTGATGGTAAAGGG - Intergenic