ID: 953634695

View in Genome Browser
Species Human (GRCh38)
Location 3:44652803-44652825
Sequence CTGAGGTATTGAAAGTGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953634691_953634695 5 Left 953634691 3:44652775-44652797 CCAGTCTCCTAGGTTGACCAACA 0: 1
1: 0
2: 0
3: 7
4: 78
Right 953634695 3:44652803-44652825 CTGAGGTATTGAAAGTGTCCAGG 0: 1
1: 0
2: 0
3: 16
4: 151
953634692_953634695 -2 Left 953634692 3:44652782-44652804 CCTAGGTTGACCAACAGAGTACT 0: 1
1: 0
2: 0
3: 4
4: 73
Right 953634695 3:44652803-44652825 CTGAGGTATTGAAAGTGTCCAGG 0: 1
1: 0
2: 0
3: 16
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953634695 Original CRISPR CTGAGGTATTGAAAGTGTCC AGG Intronic
900534227 1:3169130-3169152 CTGAGGCTCAGAAAGTGTCCAGG - Intronic
902794941 1:18794927-18794949 CAGAGGTGTGGAAAGTGCCCCGG - Intergenic
903756648 1:25666795-25666817 CTGAGATTTTGAAAGAGTCCCGG + Intronic
903756962 1:25668999-25669021 CTGAAATTTTGAAAGAGTCCGGG + Intronic
904373953 1:30068033-30068055 CTGTGCTATTGATAGTGCCCTGG + Intergenic
906829937 1:49020559-49020581 CTGAGGGCCTGAAAGTGTTCAGG - Intronic
907058392 1:51394732-51394754 CTGAGGTATTGGCAGTTTCCTGG - Intronic
909924511 1:81423364-81423386 CTGTGTTCTAGAAAGTGTCCTGG - Intronic
915370597 1:155346507-155346529 ATGACTTATTGAGAGTGTCCTGG + Intronic
920123583 1:203676349-203676371 CTGAGGGATTGGAAGTGGCCAGG + Intronic
923396815 1:233573838-233573860 TTGGGGTAATGAAAATGTCCTGG - Intergenic
924006276 1:239615173-239615195 CTGGGACATAGAAAGTGTCCAGG - Intronic
1063086904 10:2828038-2828060 CAGTTGTATAGAAAGTGTCCAGG - Intergenic
1063947351 10:11191142-11191164 CTGATGTATTGAAAGGCACCTGG + Intronic
1066467504 10:35666658-35666680 CTGAGGTGGTGACAATGTCCTGG - Intergenic
1067016603 10:42760655-42760677 CTGAAGGATCGAAAGTGTTCAGG + Intergenic
1068174240 10:53437200-53437222 CTGAGTTATTCAAATTGTACTGG + Intergenic
1068770659 10:60817368-60817390 CTGAGGAACTGAAAGTTCCCTGG + Intergenic
1068938596 10:62658895-62658917 CTGTGGTCATGATAGTGTCCCGG - Intronic
1069080069 10:64079182-64079204 CTGAGGTAATGGCAGAGTCCAGG + Intergenic
1075533680 10:123252468-123252490 ATGAGGTCTTGTGAGTGTCCCGG + Intergenic
1076688246 10:132207863-132207885 CTGAGGTGTGAAATGTGTCCGGG + Exonic
1078334436 11:10452240-10452262 CTCAGGTCTTGAAAATGTCATGG + Intronic
1081067814 11:38568464-38568486 CTGAAGTTTTAAAAATGTCCAGG + Intergenic
1081636110 11:44723360-44723382 CAGAGGTATTGAAAGCACCCTGG + Intergenic
1086042898 11:82500245-82500267 CTGAGGTAGTGAATGTCTTCTGG - Intergenic
1093285839 12:17261479-17261501 CTTAGGTATTAAAATTGTTCTGG - Intergenic
1095412524 12:41939424-41939446 CTGAAGTTATGTAAGTGTCCAGG - Intergenic
1096115431 12:49052222-49052244 CTGAGGCATTGCACCTGTCCCGG - Exonic
1100297757 12:93278512-93278534 ATGAGGTATTTATTGTGTCCTGG - Intergenic
1104146435 12:126038192-126038214 CTCAGGTAATAAAAGTATCCAGG + Intergenic
1104179267 12:126362629-126362651 ATGAGGTATTGAAAGAGAACTGG + Intergenic
1105653596 13:22408251-22408273 CTGAGGGACTGAGAGTTTCCTGG + Intergenic
1106551343 13:30773802-30773824 GTGAGTTATTGAAAGTGTTTGGG + Intergenic
1111184267 13:84711089-84711111 ATGAGGAATAGAAAGTGTCTGGG - Intergenic
1120110595 14:80550475-80550497 CTGAGTTATTTAAAGTTTACTGG - Intronic
1121925292 14:97921736-97921758 TTTAGGTATTGAAAGCATCCTGG + Intergenic
1123792846 15:23740051-23740073 CTGGGGTAATGAAAATGTTCTGG - Intergenic
1127071904 15:55295741-55295763 CTGAGGTGATGAAACTGTCTTGG + Intronic
1130061542 15:80574064-80574086 CTGAGGTATGGGAAAAGTCCTGG + Intronic
1130898968 15:88192786-88192808 CTGAGGGATTGAAAGAAGCCAGG - Intronic
1131182565 15:90250454-90250476 CTGAGGAATGGGATGTGTCCAGG - Intronic
1131369142 15:91865273-91865295 CTGAGATATTGAAAATGTTAGGG - Intronic
1131952142 15:97692577-97692599 CAGAGGGAGTGAAAGTGTTCTGG + Intergenic
1132472969 16:117020-117042 CTGGGGTGGTGAAAGTGTTCTGG + Intronic
1132477038 16:144965-144987 CTGAGGCGATGAAAATGTCCTGG - Intergenic
1133327280 16:4949396-4949418 CTGAGGTACTCAGAGTGTCTGGG - Intronic
1134046862 16:11107567-11107589 CTTTTGTCTTGAAAGTGTCCTGG + Intronic
1134420974 16:14089256-14089278 TTGGGGTGATGAAAGTGTCCTGG - Intronic
1135470536 16:22725696-22725718 GGGAGGTATTGGAAGTCTCCAGG + Intergenic
1139416565 16:66815968-66815990 CTGAGTGATTAAAAGTGTGCTGG - Intronic
1141197378 16:81870313-81870335 CTGAGGGTTTGAAAGGGTCAAGG + Intronic
1141232561 16:82183128-82183150 CTAAGTTCTGGAAAGTGTCCTGG - Intergenic
1141787264 16:86209943-86209965 CTGGGGTAATGGAAATGTCCTGG - Intergenic
1142794178 17:2294468-2294490 CTGAGGTACAGAAAGTGACCGGG - Intronic
1143625116 17:8105281-8105303 CAGAGGTATAGTAAGTGTGCAGG - Intronic
1144829776 17:18124661-18124683 CTGAGGCTCTGAAAATGTCCTGG - Intronic
1145841565 17:27999519-27999541 CTGACATATAGAAAGTGTGCAGG + Intergenic
1147867456 17:43562575-43562597 CTGAGGCATAGAAAGGTTCCAGG - Intronic
1149559309 17:57596763-57596785 CTGAGGTCTTGACAGCCTCCTGG - Intronic
1149609827 17:57952124-57952146 CTTGGGAATTGAAAGTGTCTTGG - Intronic
1150415929 17:64988799-64988821 CTGAGGGATTGAGGCTGTCCCGG + Intergenic
1150685293 17:67315855-67315877 TTGAGGTAGTGAAAGTGTTTTGG - Intergenic
1150795777 17:68235577-68235599 CTGAGGGATTGAGGCTGTCCCGG - Intergenic
1151897542 17:76990435-76990457 CTGAGATGTGGAGAGTGTCCTGG - Intergenic
1154155111 18:11937978-11938000 CGGAGATATTGAAAGTGATCAGG + Intergenic
1154942344 18:21127003-21127025 CGGGAGTATTGAAAGTGTCCTGG - Intergenic
1155278703 18:24216023-24216045 CTAAGATATTGAAAAAGTCCAGG + Intronic
1156411373 18:36830791-36830813 GTGAGGAATTGAAATTGTACAGG + Intronic
1156496534 18:37529478-37529500 CTGAGCTATTGGATGTGCCCTGG - Intronic
1157083459 18:44553116-44553138 CTGAGATGTTGAAAGTTTCCAGG - Intergenic
1160252406 18:77214412-77214434 CGGGCGTAGTGAAAGTGTCCTGG - Intergenic
1161344773 19:3762861-3762883 CTGAGGAATTGACAGTGCGCAGG + Intronic
1166841737 19:45701619-45701641 CTGAGGGATTGAATGAGACCAGG + Intronic
1166954188 19:46451745-46451767 CAGAAGGATTCAAAGTGTCCTGG - Intergenic
928015984 2:27657551-27657573 CTGTGCTAATGAGAGTGTCCTGG - Exonic
930711739 2:54556840-54556862 CTGAGGTTTAGAAAGAATCCAGG + Intronic
931184094 2:59932779-59932801 CTGAGCTATGGTAAGTGACCTGG - Intergenic
932220863 2:69997992-69998014 CTGAGGCATAGAAAGTCTCAGGG + Intergenic
933101258 2:78261252-78261274 CTAAGATTTTGAATGTGTCCTGG + Intergenic
933521336 2:83378494-83378516 CTGAAGTCTTAAAAGTGTTCTGG - Intergenic
935503741 2:103873312-103873334 ATGAGGTATTGAAATGATCCAGG - Intergenic
937656557 2:124383319-124383341 CCGAGGTCTTGAAAGTTTACAGG + Intronic
939727605 2:145742447-145742469 ATGAAGTAGTGAAATTGTCCCGG - Intergenic
940852489 2:158701763-158701785 ATGAGTTATAGAATGTGTCCAGG + Intergenic
941081925 2:161071654-161071676 CTGAGGAATTTAAAGTGTCTTGG - Intergenic
947820687 2:233067148-233067170 TCGAGGTATTGAGAATGTCCTGG - Intronic
1169013801 20:2274548-2274570 CTGAGGTATTGGTAGTGGGCTGG - Intergenic
1169390031 20:5182917-5182939 CTGACTTATTGAAAGTGAACAGG - Intronic
1170020306 20:11830041-11830063 CTGAGGTATTCACTGTGTCATGG - Intergenic
1170565253 20:17597793-17597815 CTGAAGTAATGAAAATGTTCTGG - Intronic
1175818948 20:61898131-61898153 GTGAGGCATGGACAGTGTCCCGG - Intronic
1178699551 21:34821307-34821329 ATTAAGTATTGAAAGTGTACCGG + Intronic
1179073234 21:38092876-38092898 GTTAGGGATTGAAAGTGTCAGGG + Intronic
1179245076 21:39626030-39626052 CTGGGGTAATGAAAATGTCCTGG - Intronic
1181502928 22:23329104-23329126 CTGAGGTATTGAACATGTTATGG - Intergenic
1183601332 22:38842335-38842357 CTGGGGTAGTGAATGTGTCCCGG + Intronic
949544068 3:5057288-5057310 CAGAGGCATTGCCAGTGTCCAGG + Intergenic
953449052 3:42991108-42991130 CTGAGGTCTTGGGAGTCTCCTGG + Intronic
953634695 3:44652803-44652825 CTGAGGTATTGAAAGTGTCCAGG + Intronic
960018974 3:112927634-112927656 CTGAGGCAATGAGAGTGTCCAGG + Intronic
960255147 3:115503853-115503875 CTAAGGTATTGAAAGTGGGGAGG - Intergenic
961367796 3:126412315-126412337 CTGAGGTGGGGAAACTGTCCCGG - Intronic
961460689 3:127048341-127048363 TTGGGGTAATGAAAATGTCCTGG - Intergenic
965373261 3:167890909-167890931 CTGAAGTGTTGAGAGGGTCCGGG + Intergenic
965887774 3:173469694-173469716 CTGATGTGTTGAAAGTGTTTTGG - Intronic
966490506 3:180523081-180523103 TTGAGGTAATGAAAATGTCCTGG - Intergenic
967695954 3:192530698-192530720 CTGAGGTGATGAAAGTGTTCAGG + Intronic
970447491 4:16136319-16136341 AGGAGGTATTGAGAGTATCCAGG - Intergenic
971717052 4:30191479-30191501 TTGAGGTAATGAAAATGTTCTGG + Intergenic
981265331 4:142776518-142776540 CTTAGGTATTGGAAGTTGCCAGG + Intronic
982155164 4:152512781-152512803 TTGAGGTAATGAAAATGTTCTGG + Intronic
982499046 4:156130896-156130918 CTGAGGAATTCAAGGTGTCTAGG + Intergenic
983642766 4:169958482-169958504 CTGATGTATTCAAGGTGTCTGGG - Intergenic
989427018 5:41307643-41307665 CTGAGGTATAGACACTGCCCTGG - Exonic
990931852 5:61100647-61100669 CTGTGGTAGAGAAAGTTTCCAGG - Intronic
992245517 5:74818408-74818430 CTGAGGTGATGAAAATGTTCAGG + Intronic
992940520 5:81756911-81756933 CTGAGGTATTGACAGTAACAAGG + Intergenic
993697404 5:91078073-91078095 CTGAGGTATTTAGAATCTCCTGG + Intronic
993740948 5:91539080-91539102 TTGAGAAAATGAAAGTGTCCTGG - Intergenic
995225459 5:109695472-109695494 CTGAAGTGTTGAGAGTTTCCTGG + Intronic
996652805 5:125901529-125901551 CTGAGCTCTGGAAACTGTCCTGG + Intergenic
998820468 5:146053298-146053320 CTGAGCCAATGAAAGTCTCCAGG - Intronic
999351600 5:150876467-150876489 CTTAGGTAGGAAAAGTGTCCAGG - Intronic
999593570 5:153176472-153176494 TTGGTGTATTGAAAGTGTTCAGG + Intergenic
1001629143 5:173161527-173161549 CTGGGGTGTTGAGAGGGTCCCGG + Intronic
1002032712 5:176442312-176442334 ATGAGGTGTCCAAAGTGTCCAGG + Intergenic
1004696577 6:18039658-18039680 CTGGGGTGATGAAAGTGTTCTGG + Intergenic
1005161620 6:22870968-22870990 CTGAGGTATAGCAAGTGCCAGGG + Intergenic
1012696545 6:102391417-102391439 CTGAGCTAATGAAAGTGGCAGGG - Intergenic
1015348603 6:132189925-132189947 ATGAAGTATTGAAAGTGTTTTGG + Intergenic
1017155752 6:151321285-151321307 ATGAGGTAATGAAAATGTCCTGG - Intronic
1019833048 7:3352815-3352837 TTGAGGTATTCACAGTGTCTGGG + Intronic
1019856957 7:3618902-3618924 CTGGGGTATTGCATGTTTCCAGG + Intronic
1023606586 7:41936912-41936934 CTGTTGTATTGCAAGTTTCCTGG - Intergenic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1028555035 7:92114005-92114027 ATGTGGTATTGAAAATCTCCTGG - Intronic
1029518370 7:101042911-101042933 AGGAGGTGTTGAAAGTGTGCTGG - Exonic
1036394736 8:8359983-8360005 CAGAGGAATTGACAGTTTCCAGG - Intronic
1038038676 8:23706465-23706487 CTCAGGTACTGAAAGTTTTCCGG + Exonic
1039407486 8:37325855-37325877 CTGGGAAATTGGAAGTGTCCTGG - Intergenic
1042484769 8:69337365-69337387 CTGAGGTGGTGACAGTGGCCAGG - Intergenic
1044174897 8:89107718-89107740 CTGAAGAATTGACAGGGTCCTGG + Intergenic
1044522519 8:93215881-93215903 CTGAGGTATGGAAAGTGAACTGG + Intergenic
1045133675 8:99188254-99188276 TTGAGGTTTTGAAAATGTTCTGG - Intronic
1045807440 8:106181012-106181034 CTGACATATTTGAAGTGTCCTGG + Intergenic
1047307257 8:123662924-123662946 CTGAGGTATTGAGGGAGTGCTGG + Intergenic
1048081933 8:131138008-131138030 CTGAGGTACTGACATTGTCCTGG + Intergenic
1048943343 8:139422181-139422203 CTGAGGAGCTCAAAGTGTCCAGG - Intergenic
1049158111 8:141079393-141079415 TTGAGGTGATGAAAATGTCCTGG - Intergenic
1051167591 9:14280797-14280819 CTCAGGTATAGAAGGTGGCCAGG + Intronic
1052986551 9:34492078-34492100 CTGAGGCATTAAAAGTGACATGG - Intronic
1057450625 9:95155645-95155667 CAGAGGTTTTTAAAGTCTCCTGG + Intronic
1057732800 9:97625077-97625099 TTGAGGTATTGGAAATGTTCTGG - Intronic
1058530623 9:105901901-105901923 CTAAGGTCCTGAAAGTGTCAGGG + Intergenic
1058859861 9:109105706-109105728 CTGAGGTAATGAAAATGTCTTGG + Intronic
1059639145 9:116199622-116199644 ATGGAGAATTGAAAGTGTCCTGG - Intronic
1060734305 9:126056659-126056681 CTGAGGTCTTGGAAGAGGCCCGG + Intergenic
1061180318 9:129021651-129021673 CTGACCTCTTGAAAGTGACCAGG + Intronic
1061929343 9:133824441-133824463 CTGGGGTTTTAAGAGTGTCCTGG - Intronic
1187626171 X:21116629-21116651 CTGAGGAACTGAAAATGTTCTGG + Intergenic
1188693791 X:33162578-33162600 CTGAGGGATTGGAAGAGTCAGGG + Intronic
1198301206 X:135335472-135335494 GTGAGGTAGGGACAGTGTCCTGG - Intronic
1198308428 X:135405395-135405417 ATGAGGTATTCAAAATGGCCAGG - Intergenic
1199406672 X:147470175-147470197 CTGAAATATTAAAATTGTCCAGG + Intergenic
1200874884 Y:8143478-8143500 CAGAGTTATGGTAAGTGTCCAGG + Intergenic
1201052967 Y:9958689-9958711 CAGAGTTATGGTAAGTGTCCGGG + Intergenic
1201604530 Y:15770866-15770888 CTGACCTCTTGAAAGTGACCAGG - Intergenic