ID: 953635864

View in Genome Browser
Species Human (GRCh38)
Location 3:44663636-44663658
Sequence CAGGCTAAGAGCTCTGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953635861_953635864 12 Left 953635861 3:44663601-44663623 CCCAAGTTGCTGAGAGCTATCAG No data
Right 953635864 3:44663636-44663658 CAGGCTAAGAGCTCTGTTGCAGG No data
953635860_953635864 19 Left 953635860 3:44663594-44663616 CCATTTTCCCAAGTTGCTGAGAG No data
Right 953635864 3:44663636-44663658 CAGGCTAAGAGCTCTGTTGCAGG No data
953635862_953635864 11 Left 953635862 3:44663602-44663624 CCAAGTTGCTGAGAGCTATCAGA No data
Right 953635864 3:44663636-44663658 CAGGCTAAGAGCTCTGTTGCAGG No data
953635859_953635864 20 Left 953635859 3:44663593-44663615 CCCATTTTCCCAAGTTGCTGAGA No data
Right 953635864 3:44663636-44663658 CAGGCTAAGAGCTCTGTTGCAGG No data
953635858_953635864 21 Left 953635858 3:44663592-44663614 CCCCATTTTCCCAAGTTGCTGAG No data
Right 953635864 3:44663636-44663658 CAGGCTAAGAGCTCTGTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953635864 Original CRISPR CAGGCTAAGAGCTCTGTTGC AGG Intergenic
No off target data available for this crispr