ID: 953636098

View in Genome Browser
Species Human (GRCh38)
Location 3:44666385-44666407
Sequence GTGCACACGCACACGTATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953636098_953636101 26 Left 953636098 3:44666385-44666407 CCCATATACGTGTGCGTGTGCAC No data
Right 953636101 3:44666434-44666456 TAATTGAGACCTCTGTGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953636098 Original CRISPR GTGCACACGCACACGTATAT GGG (reversed) Intergenic
No off target data available for this crispr