ID: 953643566

View in Genome Browser
Species Human (GRCh38)
Location 3:44731678-44731700
Sequence AATGCAGGACCACACAGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 375}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953643557_953643566 24 Left 953643557 3:44731631-44731653 CCTATGGTGGGACCCACCAATGT 0: 1
1: 0
2: 0
3: 6
4: 51
Right 953643566 3:44731678-44731700 AATGCAGGACCACACAGAAATGG 0: 1
1: 0
2: 2
3: 28
4: 375
953643561_953643566 8 Left 953643561 3:44731647-44731669 CCAATGTCCACTAAATGTGGACC 0: 1
1: 0
2: 0
3: 2
4: 42
Right 953643566 3:44731678-44731700 AATGCAGGACCACACAGAAATGG 0: 1
1: 0
2: 2
3: 28
4: 375
953643559_953643566 11 Left 953643559 3:44731644-44731666 CCACCAATGTCCACTAAATGTGG 0: 1
1: 0
2: 0
3: 4
4: 83
Right 953643566 3:44731678-44731700 AATGCAGGACCACACAGAAATGG 0: 1
1: 0
2: 2
3: 28
4: 375
953643562_953643566 1 Left 953643562 3:44731654-44731676 CCACTAAATGTGGACCCAGCAGA 0: 1
1: 0
2: 0
3: 7
4: 98
Right 953643566 3:44731678-44731700 AATGCAGGACCACACAGAAATGG 0: 1
1: 0
2: 2
3: 28
4: 375
953643558_953643566 12 Left 953643558 3:44731643-44731665 CCCACCAATGTCCACTAAATGTG 0: 1
1: 0
2: 1
3: 5
4: 111
Right 953643566 3:44731678-44731700 AATGCAGGACCACACAGAAATGG 0: 1
1: 0
2: 2
3: 28
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953643566 Original CRISPR AATGCAGGACCACACAGAAA TGG Intronic
900579490 1:3401948-3401970 CATGCAGGCCCACACAAACATGG + Intronic
902399511 1:16150403-16150425 AATGCAGCCCCCCACAGGAAGGG + Intronic
903713495 1:25344875-25344897 AATGCAAGAAAACAAAGAAAAGG - Intronic
904620812 1:31773947-31773969 AATGCAGGACCACTTAAGAAGGG + Intergenic
906267193 1:44441449-44441471 AATGCATGATCATACAGAACAGG + Intronic
906341986 1:44988403-44988425 AATGCTGGACCCAACACAAATGG - Intergenic
906438326 1:45816504-45816526 AATACAGGATAACACAGATAAGG + Intronic
906735036 1:48117044-48117066 AATTCAAGATAACACAGAAAAGG + Intergenic
910384627 1:86667168-86667190 AATTCAAGATAACACAGAAAAGG + Intergenic
910741216 1:90519360-90519382 AATGAAATAACACACAGAAAAGG + Intergenic
910978481 1:92933784-92933806 AAGAAAGGACCACACATAAAGGG + Intronic
911085864 1:93977015-93977037 AGTCCAGGACCACTCAGACATGG + Intergenic
911239217 1:95447791-95447813 AATTCAAGATAACACAGAAAAGG - Intergenic
911400705 1:97371372-97371394 AATGCAAGATCACATAGCAATGG + Intronic
912871741 1:113312696-113312718 AATTCAAGATAACACAGAAAAGG + Intergenic
913071473 1:115302819-115302841 AATGCACAACCACACAGGATAGG - Intronic
913279793 1:117174865-117174887 AAGGCAGAAACACACAGAAAAGG + Intronic
913648850 1:120890124-120890146 AATGCTGGACCCAACACAAATGG + Intergenic
914077840 1:144373259-144373281 AATGCTGGACCCAACACAAATGG - Exonic
914101339 1:144593246-144593268 AATGCTGGACCCAACACAAATGG + Exonic
914172749 1:145241799-145241821 AATGCTGGACCCAACACAAATGG - Exonic
914297641 1:146344390-146344412 AATGCTGGACCCAACACAAATGG - Intergenic
914527407 1:148482927-148482949 AATGCTGGACCCAACACAAATGG - Exonic
914638987 1:149584201-149584223 AATGCTGGACCCAACACAAATGG + Exonic
915788198 1:158639031-158639053 AATACAGATACACACAGAAAAGG - Intronic
917925301 1:179784546-179784568 AATGCTGGACCAAGCAGGAAGGG - Intronic
918671474 1:187223050-187223072 AATTCAGGAGAACACAGAGAAGG - Intergenic
919067929 1:192715797-192715819 AATTCAAGATAACACAGAAAAGG + Intergenic
920549764 1:206848361-206848383 AATTCAAGATCACACAGAGAAGG + Intergenic
920589521 1:207203459-207203481 CAGATAGGACCACACAGAAAAGG - Intergenic
920908024 1:210189629-210189651 AGTGGAGGCCCACACAGACAGGG - Intergenic
921578392 1:216865067-216865089 AATGCAGATCCACTGAGAAAGGG - Intronic
921939654 1:220826904-220826926 AATCCAGGTCCCCACAGGAAGGG - Intergenic
921954090 1:220963953-220963975 GAGACAGGAGCACACAGAAAGGG + Intergenic
922087732 1:222367239-222367261 AATCCAGGACCACTGGGAAAAGG - Intergenic
923135848 1:231118001-231118023 AATGCTGGACCCAACACAAACGG - Intergenic
923361433 1:233215574-233215596 AATGCAGGACATCCCAGTAAAGG - Intronic
924629367 1:245722393-245722415 AATTCAAGATAACACAGAAATGG + Intergenic
1063205828 10:3829922-3829944 AAAGCAGGACCAGGCACAAAAGG + Intergenic
1066110146 10:32188492-32188514 AATGCTGGACCCAACACAAATGG - Intergenic
1066413389 10:35195661-35195683 AATGCAGCTCCAAACAGAATAGG + Intronic
1066960962 10:42225146-42225168 AATGAAGGAAAACACAAAAAAGG + Intergenic
1068052664 10:51970995-51971017 TATGGAGTACCACACAGCAATGG + Intronic
1068923434 10:62510267-62510289 ATTTCATGACCACAGAGAAAAGG + Intronic
1069391897 10:67944700-67944722 AATCCAAGATAACACAGAAAAGG + Intronic
1070286787 10:75089407-75089429 AATGCTGGACCCAACACAAATGG - Intergenic
1070676130 10:78412756-78412778 TATGCAGGGCCACACAGTCAGGG + Intergenic
1071767987 10:88690245-88690267 AATTCAAGACAACACAGAGAAGG + Intergenic
1072174012 10:92897814-92897836 AAGGCAGGACAACTCAGAAGTGG - Intronic
1072473609 10:95737176-95737198 AGTGCAGGACAAAACAGAAATGG + Intronic
1072482549 10:95823154-95823176 ATTACAAGACCAGACAGAAAGGG + Intronic
1073936858 10:108642750-108642772 CATACAGGACCATACATAAAAGG - Intergenic
1074578151 10:114690315-114690337 AATGCTGGACCCAACACAAACGG - Intergenic
1075163686 10:120046896-120046918 AATGAAGGACCACATATACAAGG - Intergenic
1075948445 10:126457464-126457486 AGTGCAGCACCACACTGAACAGG + Intronic
1076465235 10:130676208-130676230 ATTTCAGGAACACAGAGAAAGGG - Intergenic
1077830101 11:5858141-5858163 AATGCATAACAACACAGAAACGG - Intronic
1078611096 11:12820127-12820149 AGTGCAGAGCCACACAGCAAAGG + Intronic
1078934946 11:15941952-15941974 AATCCAGGTCCCCAAAGAAAGGG + Intergenic
1079491476 11:20993362-20993384 ACTACATGAACACACAGAAATGG + Intronic
1079729158 11:23919574-23919596 AATTCAGGATAACACAGAGAAGG - Intergenic
1081652730 11:44835159-44835181 AAGGAAGAAACACACAGAAAAGG + Intronic
1085908550 11:80794174-80794196 AACACAGAAACACACAGAAAAGG + Intergenic
1086864980 11:91970135-91970157 ACTGCAGGTTGACACAGAAAAGG - Intergenic
1087632473 11:100666768-100666790 AATGCTGGACCCAACACAAATGG + Intergenic
1089946667 11:122480869-122480891 AATTCAAGACAACACAGAGAAGG + Intergenic
1090184431 11:124727201-124727223 ACTCCAGGACCACACAGACTGGG - Intergenic
1090447931 11:126780085-126780107 AGTACAGGAAGACACAGAAAGGG + Intronic
1092721765 12:11448181-11448203 ATTGCTGGATCACACAGAATTGG - Intronic
1092818020 12:12327936-12327958 AATGCAGGAAATGACAGAAAAGG - Exonic
1093123881 12:15305862-15305884 AATTCAGGATAACACAGAGAAGG - Intronic
1093348444 12:18068906-18068928 ATTTCTGGACCACAAAGAAAGGG - Intergenic
1094176877 12:27550010-27550032 AATGCTGGACCTCAGAAAAATGG + Intronic
1094255324 12:28417907-28417929 AATGTAGGACCACTCAGTAATGG - Intronic
1094419930 12:30259377-30259399 AATTCAAGATAACACAGAAAAGG + Intergenic
1096029015 12:48395102-48395124 AATGCAGTACCACATAGAGATGG + Intergenic
1097557546 12:61158179-61158201 AATCCAAGATCACACAGAACAGG - Intergenic
1098515503 12:71372025-71372047 TATGCAATAGCACACAGAAAGGG - Intronic
1099564732 12:84229281-84229303 AATTCAGGATAACACAGAGAAGG - Intergenic
1100047385 12:90399228-90399250 AATGCAGATCCACAGAGAAAAGG - Intergenic
1100132784 12:91517120-91517142 AACCCAGCACCACACAGAGAAGG - Intergenic
1100586977 12:95989526-95989548 AATGCAGAACCACACATAGAAGG + Intronic
1100915887 12:99421511-99421533 AATGAGGGACCACAAAGAAGGGG + Intronic
1101321617 12:103677966-103677988 AATGGAGGACAACGCAGAGAAGG + Intronic
1102044243 12:109819952-109819974 AATGGTGGTCCACACAGAGATGG + Intronic
1102604495 12:114058178-114058200 ACTGGGGGACCACACAGACAGGG - Intergenic
1103138049 12:118524908-118524930 AATGCTGGAAAATACAGAAAAGG + Intergenic
1105280847 13:18961800-18961822 AATGCAGGACCAGATTGAACAGG - Intergenic
1105412126 13:20179146-20179168 AATGCTGGACCCGACACAAATGG - Intergenic
1106930612 13:34660038-34660060 AAACCAGGACCACATAGGAAGGG + Intergenic
1107707595 13:43122874-43122896 AATGAAAGAGCACACAGATAAGG - Intergenic
1107947916 13:45436471-45436493 AATGCTGGACCCAACACAAACGG + Intergenic
1107961474 13:45563242-45563264 ACTGTGGGACCACACAGTAAGGG - Intronic
1108686179 13:52820830-52820852 AATGCTGGACCCAACACAAATGG + Intergenic
1108816663 13:54301008-54301030 AATGTATGACCTTACAGAAAAGG - Intergenic
1109583456 13:64369910-64369932 AATGCAAGACAACACAAAGAAGG - Intergenic
1111633868 13:90878198-90878220 AATGAAGAATAACACAGAAATGG - Intergenic
1111802940 13:93002514-93002536 AATGCAGGAGGACACCCAAATGG - Intergenic
1112658233 13:101475182-101475204 AATTCAGGATAACACAGAGAAGG + Intronic
1114455144 14:22849142-22849164 AATGGAGGACCAGAGACAAAGGG + Intergenic
1114723150 14:24904662-24904684 AGTGCATGACCACAGAGGAAAGG + Intronic
1116147595 14:41095437-41095459 ATTACAGGACCATACAGAATAGG + Intergenic
1116946510 14:50840397-50840419 GATGGAAGAACACACAGAAATGG - Intergenic
1117783711 14:59260574-59260596 AATGAAGGACTATACAGAAAAGG - Intronic
1118699774 14:68421869-68421891 AATGCTGGACCCAACACAAATGG - Intronic
1119017348 14:71072906-71072928 AATGAAGGACCAAAGAGTAAAGG - Intronic
1119460773 14:74801341-74801363 AATGAGGGACCACAAAGTAAGGG - Intronic
1119465398 14:74853994-74854016 AATGCAGCATCACACAGAAATGG - Exonic
1120172982 14:81264709-81264731 AATGCAGGAAGGCACAGTAAGGG + Intronic
1121485585 14:94312164-94312186 AATGCAGGACCAGACATTGATGG - Intronic
1123942313 15:25222543-25222565 CATGCAGGAGCACAGAGACAGGG - Intergenic
1125445044 15:39745169-39745191 AAGGCAGGAAGAAACAGAAAGGG + Intronic
1127045836 15:55024677-55024699 AAGGCAGCACCACAAAGCAATGG - Intergenic
1128507735 15:68288135-68288157 AATTAAGGACCACACACAAGAGG - Intronic
1128900873 15:71422049-71422071 AATTCAGGACAACACAGAGAAGG - Intronic
1129628756 15:77234621-77234643 AATGGATGAACACACAGAATTGG + Intronic
1129716526 15:77854925-77854947 AACGGAGTACCACACATAAAAGG + Intergenic
1131016957 15:89065816-89065838 AATGCAGGATCCCAGGGAAAAGG + Intergenic
1131062521 15:89412696-89412718 CATTCTGGACCCCACAGAAAGGG + Intergenic
1131362915 15:91809943-91809965 AATGCAGGAACACATGGACAAGG + Intergenic
1133634737 16:7654210-7654232 AATGCTGGAGAACAGAGAAATGG + Intronic
1135090763 16:19514312-19514334 AATGATGGAGCACTCAGAAAGGG - Intronic
1140346817 16:74221230-74221252 AATGCTGGACCCAACACAAACGG + Intergenic
1140901899 16:79375776-79375798 AATGCAGCAGGACAGAGAAAAGG - Intergenic
1141137533 16:81476194-81476216 AATGCTGGACCCAACACAAACGG - Intronic
1143726926 17:8854531-8854553 GAAGCAGGCCCACACAGATATGG + Intronic
1144056702 17:11549750-11549772 ATGGCAGGATCACAGAGAAATGG - Intronic
1144467362 17:15507162-15507184 AATGCAGGACCCGATACAAACGG + Intronic
1146070214 17:29673634-29673656 AATTAGGGACCTCACAGAAAAGG + Intronic
1146430066 17:32784792-32784814 CATGCACAACCCCACAGAAAAGG + Intronic
1150216242 17:63471901-63471923 AATGCTGGACCCAACACAAATGG + Intergenic
1150622195 17:66815983-66816005 AATGCATGACCATTCAGTAAGGG + Intergenic
1150820584 17:68431226-68431248 AGTCCAGGACCACAGAGGAAGGG + Intronic
1152339374 17:79715901-79715923 TCTGCAGGTCCACACAGGAAAGG + Intergenic
1152421804 17:80197580-80197602 AGTGCAGGCCCACGCAGACATGG + Intronic
1152438036 17:80288138-80288160 ATTCCAGGACCACACGGAAGGGG + Exonic
1154983726 18:21527773-21527795 AATGCAGGACTAAACACACAGGG + Intergenic
1156094419 18:33511496-33511518 AATTCAGGATAACACAGAGAGGG + Intergenic
1156599811 18:38592158-38592180 AAAGCAGGAGCACAGAGAATTGG - Intergenic
1156680050 18:39577442-39577464 AATGAAGGACTAAAGAGAAATGG - Intergenic
1156709282 18:39924066-39924088 ATTGCAGGACAAAACAAAAAGGG + Intergenic
1157447288 18:47755069-47755091 AAGGCAGGGCCAGACAGAACCGG + Intergenic
1157888447 18:51391413-51391435 AATGCAGGTACACACAAAGAAGG - Intergenic
1157937141 18:51885142-51885164 AATTCAAGAAAACACAGAAAAGG + Intergenic
1158027113 18:52913319-52913341 AATTCAGAATCAAACAGAAATGG - Intronic
1158862135 18:61603039-61603061 AATGCAGAGTCACACAGCAAAGG + Intergenic
1159806231 18:72961553-72961575 AATAAAGGATCCCACAGAAAGGG - Intergenic
1161167639 19:2796810-2796832 AAGGCAGGTCCACACAGACATGG + Intronic
1164655881 19:29921470-29921492 AATGCTGGACCCAACACAAACGG + Intergenic
1166408164 19:42538548-42538570 AATTCAAGACGACACAGAGAAGG - Intronic
1167723211 19:51193104-51193126 AACAAAGGACCACACAGGAACGG + Intergenic
925553135 2:5097618-5097640 AATCCAGCATCACAAAGAAAAGG - Intergenic
925721218 2:6829599-6829621 AATGCAAAACCACACCTAAAAGG + Intergenic
926762666 2:16292515-16292537 AATGCAGTGTCACACAGTAAAGG - Intergenic
926999086 2:18773498-18773520 CAAGCAGGTCCAAACAGAAAAGG - Intergenic
927009975 2:18893291-18893313 AATTCAGGGCCACACTGAACTGG + Intergenic
927712414 2:25334047-25334069 AAGGCAGGAACAGACATAAAAGG - Intronic
927798478 2:26074108-26074130 AATGCAGGATGATACAGAAGAGG + Intronic
927807684 2:26162357-26162379 AATGCAGGGCCAGACACCAATGG + Intergenic
927935781 2:27075570-27075592 AATGCTGGAACAAACAGAAATGG - Intergenic
929651081 2:43680008-43680030 AATGCTGGAAGACCCAGAAAGGG - Intronic
929723736 2:44401062-44401084 AATGCAGGACAGCACATAATAGG - Intronic
929906537 2:46050932-46050954 AAGGGAGGACCACAAAGAACTGG - Intronic
929950876 2:46408801-46408823 AAGGCCGGACCACGAAGAAAGGG + Intergenic
929962153 2:46504903-46504925 AATGAAGGCCCACAGAGAAGGGG - Intronic
929994678 2:46817853-46817875 AATGCAGGACCTCCCAAGAATGG + Intronic
930617828 2:53612261-53612283 AATGCAGTTCCAGACATAAAGGG + Intronic
930895301 2:56439461-56439483 AATCCAGGATAACACAGAGAAGG - Intergenic
930944737 2:57060570-57060592 AATTCAAGATAACACAGAAAAGG - Intergenic
931805931 2:65804023-65804045 GATGCAGGAAAACACAGAGATGG + Intergenic
931894697 2:66716181-66716203 AATGCAGGCCCACAGATTAATGG - Intergenic
933259402 2:80115216-80115238 AAGGCTGGCCCACACAGCAAGGG - Intronic
933613789 2:84463201-84463223 ACTGCAGGAACATACAGCAAGGG + Intergenic
934042861 2:88144233-88144255 CATGGAGGACTTCACAGAAATGG + Intergenic
934051793 2:88217540-88217562 AATGAAGGACTACACAGATGGGG + Intergenic
934523658 2:95035261-95035283 AATGCTGGACCAGACAGGAGTGG - Intronic
934525336 2:95048339-95048361 CATGCAGGAGAACACAGAACAGG - Intronic
934882001 2:97991324-97991346 CATGCAGGACTGAACAGAAATGG + Intronic
937194174 2:120135047-120135069 AATTCAAGATAACACAGAAAAGG + Intronic
939443044 2:142274876-142274898 AATTCAAGATAACACAGAAAAGG - Intergenic
940415170 2:153411385-153411407 ACTGTGGGACCACACAGGAATGG + Intergenic
940738634 2:157481395-157481417 AATTCAAGAGAACACAGAAAAGG + Intronic
941160261 2:162027379-162027401 ACTTGTGGACCACACAGAAATGG + Intronic
942192692 2:173486037-173486059 AATGCTGGACCCAACACAAATGG - Intergenic
942352489 2:175066677-175066699 AATTCAAGATAACACAGAAAAGG + Intergenic
942477093 2:176338883-176338905 AATGCTGGACCCAACACAAATGG + Intergenic
942769257 2:179496074-179496096 AATTCAAGACAACACAGAGAAGG + Intronic
942975561 2:182013933-182013955 AATTCAAGATAACACAGAAAAGG - Intronic
943164515 2:184302843-184302865 AAAGCAAGACCACAGATAAATGG + Intergenic
943271797 2:185814656-185814678 ACTGCAGGACCAAACTCAAAAGG - Intronic
943458771 2:188142936-188142958 AATGCAGTACCAAACATAGATGG + Intergenic
944560389 2:200930185-200930207 AATGCAGGATAACCTAGAAATGG + Intronic
944953753 2:204784078-204784100 AATGAAAGAACACATAGAAAGGG + Intronic
945066142 2:205949393-205949415 AATGCTGGACCCAACAAAAATGG + Intergenic
945210394 2:207376319-207376341 AATTCAAGATAACACAGAAAAGG + Intergenic
945739602 2:213644243-213644265 AATTCAAGACAACACAGAGAAGG - Intronic
948253819 2:236551731-236551753 AATGCTGGTTCACACTGAAAAGG - Intergenic
1168917073 20:1499001-1499023 AATTCAAGACAACACAGAGAAGG - Intergenic
1170398704 20:15957020-15957042 AAAGCAAGAAGACACAGAAAAGG + Intronic
1170668537 20:18407667-18407689 AATTCAAGATAACACAGAAAAGG + Intronic
1170767408 20:19302066-19302088 ATTCCAGGAACACCCAGAAAGGG + Intronic
1170775877 20:19374288-19374310 CATGCAAGACCAGAAAGAAATGG - Intronic
1171470646 20:25368444-25368466 AATGCTGGACCCAACACAAACGG - Intronic
1172055732 20:32152994-32153016 CATGCAGGAACACAAAGGAAGGG + Intronic
1172711837 20:36931015-36931037 TAGGCAGGAACACACACAAACGG + Intronic
1172749168 20:37237739-37237761 AATGCAGAACCACCAGGAAAAGG - Intronic
1172794952 20:37530342-37530364 AATGCTGGACCCAACACAAACGG + Intergenic
1173127045 20:40346709-40346731 AATTCAGGATAACACAGAGAAGG + Intergenic
1176899494 21:14421552-14421574 AATTCAGGATAACACAGAGAAGG + Intergenic
1176939713 21:14910357-14910379 AATTCAGGATGACACAGAGAAGG - Intergenic
1177023912 21:15897240-15897262 AATTCAAGATCACACAGAGAAGG + Intergenic
1177271796 21:18858082-18858104 AATGCTGGACCCAACACAAATGG + Intergenic
1177278532 21:18948296-18948318 AATGCAGTACTACATAGATAGGG - Intergenic
1179535694 21:42050030-42050052 GAAGCAGGACCACAGAGCAAGGG - Intergenic
1181620944 22:24090799-24090821 AATCCAGGACCACAGAGAGGAGG + Intronic
1181854435 22:25772088-25772110 AGTGCAGGACCACAGCGAAGAGG + Intronic
1182695997 22:32199799-32199821 AGTGCAGGACCCCTCAGACATGG - Intronic
1182912966 22:34002898-34002920 ATTGCAGAACAACACAGAAGAGG - Intergenic
1183197326 22:36362462-36362484 ACTTCAGGACCACAGAGACATGG + Intronic
950499034 3:13352482-13352504 CTTGCAGGACCTCACAGCAAAGG + Intronic
950924272 3:16724678-16724700 AAAGCAAAACCACACAGATAAGG + Intergenic
951069002 3:18303651-18303673 AAGGCAGGACCTCACAAAAATGG + Intronic
951865941 3:27307665-27307687 AATGCAGGACTAAACATAAATGG + Intronic
952290449 3:32010172-32010194 AATGCAGGTGCACAGAGGAAAGG + Intronic
952428305 3:33197938-33197960 AGTGTATGACCACACAAAAATGG - Intronic
953229221 3:41049776-41049798 AATTCAAGATAACACAGAAAAGG - Intergenic
953643566 3:44731678-44731700 AATGCAGGACCACACAGAAATGG + Intronic
953668583 3:44943839-44943861 CATGCACCACCACACACAAAGGG - Intronic
954473395 3:50719652-50719674 AATGCTGGACCCAACACAAATGG - Intronic
954634053 3:52062033-52062055 AATGCTGGGCCCCACAGGAAAGG - Intergenic
955199466 3:56837348-56837370 AATGCAGGACCACAAGACAAGGG - Intronic
955608507 3:60732312-60732334 AATGCTGGACCCAACACAAATGG - Intronic
956927558 3:74005453-74005475 AATGCGGGTGCACAGAGAAAAGG + Intergenic
957953612 3:87155384-87155406 AAACCATAACCACACAGAAAGGG + Intergenic
958020845 3:87994097-87994119 AATGAAGAACCCAACAGAAAGGG + Intergenic
960436728 3:117635306-117635328 CATGCCGCACCACACACAAATGG - Intergenic
961355787 3:126339177-126339199 AGAGCAGGACCTCACAGAATGGG + Intergenic
961492324 3:127264464-127264486 AAGGCGGGACCACACAGCAGTGG + Intergenic
962741339 3:138364575-138364597 AGTGTAGGACCACAGGGAAATGG + Intronic
964655366 3:159061059-159061081 AATGGAGGAGAACACAGAGATGG - Intronic
964704217 3:159601364-159601386 AACACAGCACCACACAGAAGGGG + Intronic
965035075 3:163427161-163427183 AATTCAAGATAACACAGAAAAGG + Intergenic
965048426 3:163611467-163611489 AAAGCAGAAACATACAGAAAGGG - Intergenic
965098954 3:164272659-164272681 AGTGCAGGATGAGACAGAAAAGG - Intergenic
965161056 3:165134378-165134400 AATCAAAGACCACATAGAAAGGG - Intergenic
965476909 3:169167358-169167380 AATGGCTGACCACATAGAAAAGG - Intronic
965482787 3:169240933-169240955 AATCCAGGTCCACACGGAGAGGG - Intronic
965498435 3:169428011-169428033 AATGCATGGGCACAGAGAAAAGG + Intronic
965520486 3:169664564-169664586 AATGAAGTGCCACTCAGAAATGG + Intergenic
966329139 3:178791219-178791241 AATTCAAGACAACACAGAGAAGG + Intronic
966421534 3:179739188-179739210 CATGCAGGACCCTACAGAAGTGG - Intronic
966680566 3:182637835-182637857 AAGGCAGGGCAACACAGAACAGG - Intergenic
966905151 3:184518110-184518132 AATGCTAGACCACATAGAAAGGG + Intronic
966958373 3:184908462-184908484 AATGCAGCAGCACCCAGACAAGG + Intronic
967348876 3:188489942-188489964 TTTGCAGGACCAAACAGAAAAGG - Intronic
968552295 4:1229869-1229891 CATGGAGGACCACACAGACCAGG + Intronic
969389070 4:6877210-6877232 AGTGCAGGAGGACACGGAAAGGG - Intronic
969782816 4:9423000-9423022 AATGTAGAATCAAACAGAAAAGG + Intergenic
970304127 4:14713649-14713671 AAAACAGGACCACACATATATGG + Intergenic
970721666 4:18996127-18996149 AATGCAAAACAAAACAGAAAAGG + Intergenic
971225962 4:24751812-24751834 ATAGCAGGACCAATCAGAAAAGG - Intergenic
971630778 4:28990401-28990423 AATGCAGAAACACGCAGAGAGGG - Intergenic
972714178 4:41629492-41629514 AAACCAGGGCCACACAGAAGAGG + Intronic
974003407 4:56532588-56532610 AATGAAGAACAACAGAGAAATGG - Intronic
976728339 4:88238818-88238840 AATTCAAGATAACACAGAAAAGG - Intergenic
976826401 4:89265017-89265039 AATGCAGGCCAAAACACAAAAGG - Intronic
977022999 4:91778970-91778992 AATTCAGAACTACCCAGAAATGG + Intergenic
977664183 4:99625990-99626012 ACTGAACGACCACAGAGAAAGGG - Intergenic
977908995 4:102510206-102510228 AATTCAGGAGAACACAGAATGGG - Intronic
978031084 4:103940320-103940342 AATTCAAGATAACACAGAAAAGG + Intergenic
978460844 4:108950320-108950342 AAAGCAACACCACAGAGAAATGG + Intronic
979100121 4:116602759-116602781 AATTTAGGACAACACAGAGAAGG - Intergenic
979301573 4:119093134-119093156 AATTCATGACCACAGATAAATGG - Intergenic
980475617 4:133310484-133310506 GAAGCATGACCACACGGAAAGGG - Intergenic
981067514 4:140500245-140500267 CATGCATGACTACACAGCAAAGG - Intergenic
981140391 4:141260561-141260583 AATTCAGGATGACACAGAGAAGG + Intergenic
981804619 4:148699974-148699996 AAAGCAGGACTAGAAAGAAATGG - Intergenic
982828146 4:160026437-160026459 AATTCAAGACAACACAAAAAAGG - Intergenic
986627728 5:9738309-9738331 AGTCCAGGAGCACACAGAGATGG - Intergenic
988287621 5:29240530-29240552 AATGTAGGACTATGCAGAAATGG - Intergenic
988364251 5:30275755-30275777 CATGCAGGTCCACTCAGAATAGG + Intergenic
989629132 5:43462527-43462549 AATTCAAGATAACACAGAAAAGG + Intronic
989655188 5:43739875-43739897 TATGGACGAACACACAGAAAGGG - Intergenic
989980110 5:50633416-50633438 AATGCTGGACCCAACACAAATGG + Intergenic
991006731 5:61835337-61835359 AAAGCAGGGCCACACAGACTTGG + Intergenic
991433482 5:66572362-66572384 AATGCTGGACCCAACACAAACGG + Intergenic
992966696 5:82009768-82009790 AATGCTGGACCCAACACAAATGG - Intronic
993520364 5:88892089-88892111 AATGCTGAACCACACGCAAATGG - Intronic
993702247 5:91132464-91132486 AATGGAGAACCAAACAGGAATGG + Intronic
995617093 5:113977098-113977120 AAAGCAGAAACACATAGAAATGG - Intergenic
997106458 5:131024707-131024729 ATTGCAGGAGCACACAGAATAGG - Intergenic
997416760 5:133734962-133734984 AATGCAGGAACTCAAAGAACAGG + Intergenic
997452247 5:133993170-133993192 AATGAAGGACAAGACAGCAAGGG - Intronic
997832829 5:137165655-137165677 AATTCAGGATAACACAGAGAAGG + Intronic
998573141 5:143283297-143283319 AATGCAGGATAACAAAGAATTGG + Intronic
998951644 5:147398558-147398580 AGTGCAGTACCTAACAGAAACGG - Intronic
1000931496 5:167257067-167257089 CATGCATCACCACACAGAGATGG + Intergenic
1001602529 5:172938407-172938429 CATACAGGAGCAAACAGAAACGG - Intronic
1002861321 6:1081860-1081882 CATGCAGGATCTCACAGAATAGG + Intergenic
1004319566 6:14621848-14621870 AATGCAGGACATGATAGAAAGGG + Intergenic
1005355239 6:24976787-24976809 AATGCTGGACCCAACACAAATGG + Intronic
1005726266 6:28651810-28651832 AAGCAAGGACCACTCAGAAAGGG + Intergenic
1006123268 6:31820778-31820800 AATGCAGTGCCACCCATAAACGG + Intergenic
1006237990 6:32652476-32652498 AATGCAGGACCTCACTGAAAAGG + Intergenic
1006924605 6:37647616-37647638 AATTTAGGAAGACACAGAAAAGG + Intronic
1008498057 6:52152788-52152810 GATACAGGAACACACATAAAGGG - Intergenic
1008931851 6:56948619-56948641 AAAGCAAAACCACACAGAAGAGG + Intronic
1009301822 6:62032958-62032980 AATTCAAGATAACACAGAAAAGG + Intronic
1009329573 6:62400379-62400401 AATCCAGGATAACACAGAGAAGG - Intergenic
1009352995 6:62706453-62706475 AATTCAAGATAACACAGAAAAGG - Intergenic
1009771085 6:68143993-68144015 AATTCAAGATAACACAGAAAAGG - Intergenic
1009783329 6:68297985-68298007 AATTCAGGATAACACAGAGAAGG + Intergenic
1010062003 6:71634543-71634565 AATTCAAGACAACACAGAGAAGG - Intergenic
1010775502 6:79880022-79880044 AATTCAAGATAACACAGAAAAGG + Intergenic
1011267422 6:85536909-85536931 TATTCAGGAACACACAGAAAAGG - Exonic
1011558445 6:88592025-88592047 AATGAGGGACCACACAGCACTGG + Intergenic
1012833144 6:104230903-104230925 AATGCACTACCACACTGGAAAGG - Intergenic
1012842701 6:104350009-104350031 AATTCAGCCCAACACAGAAATGG + Intergenic
1012856257 6:104505652-104505674 AATGAAAGACCGCAGAGAAATGG + Intergenic
1015959612 6:138632951-138632973 AATTCAAGATAACACAGAAAAGG + Intronic
1019582940 7:1777179-1777201 AATGAAGCACAACACAGAACTGG - Intergenic
1019920613 7:4161090-4161112 AAGACAGGACCACACAGATTTGG + Intronic
1020083784 7:5299735-5299757 AAGGCAGGGACACTCAGAAATGG + Intronic
1020543889 7:9498687-9498709 AATACAGAAGCAAACAGAAATGG - Intergenic
1022223428 7:28339017-28339039 AATTCAAGACAACACAGAGAAGG - Intronic
1022304771 7:29136884-29136906 AATGCAGGGCCAGAGAAAAATGG - Intronic
1023358914 7:39396093-39396115 AATGGAAGACTAGACAGAAAAGG + Intronic
1023470915 7:40518195-40518217 AATGAATGACCACACTGAAATGG + Intronic
1023945500 7:44799816-44799838 AATGCTGGACCCAACACAAATGG + Exonic
1024491789 7:49994252-49994274 TATGCAGGACCACCCAAAAGTGG - Intronic
1026004970 7:66593132-66593154 AATGCATGTTCACAGAGAAAAGG - Intergenic
1026013065 7:66652038-66652060 AATGCATGTTCACAGAGAAAAGG + Intronic
1027570635 7:79861511-79861533 AACCCAGGACTACACAGCAAAGG + Intergenic
1027856506 7:83518701-83518723 AATGCAGCAGGACAGAGAAAAGG - Intronic
1029713977 7:102315802-102315824 AAGGAAGGAGCTCACAGAAAAGG + Intronic
1030160400 7:106502401-106502423 CATGCAGGGCCACACAGGGAGGG - Intergenic
1030330940 7:108269623-108269645 ACTGGAGGAACACACTGAAAAGG + Intronic
1031231468 7:119113383-119113405 AATTCAAGATAACACAGAAAAGG - Intergenic
1032928234 7:136634674-136634696 AATTCAGGACAACACAGAGAAGG - Intergenic
1033412155 7:141127837-141127859 CATGAAAGACCTCACAGAAAAGG - Intronic
1033770733 7:144548861-144548883 AACATAGGACCACACAGATAAGG + Intronic
1033877505 7:145841325-145841347 AATCCAAGACAACACAGAGAAGG - Intergenic
1034588596 7:152118898-152118920 AACGCAACACTACACAGAAATGG - Intronic
1036126725 8:6069814-6069836 GATGCAGGTACACAGAGAAAGGG - Intergenic
1038017850 8:23529806-23529828 AGTGCAGGAACCCTCAGAAAGGG - Intronic
1041987069 8:63934908-63934930 AATGGAGTAACACAGAGAAAGGG + Intergenic
1042318972 8:67455072-67455094 AATAAAGGACAACAAAGAAAAGG + Intronic
1042462986 8:69092412-69092434 TATGCATGGCCACACAAAAATGG - Intergenic
1042898535 8:73696481-73696503 AATTCAAGACAACACAGAAAGGG + Intronic
1042980409 8:74519966-74519988 AATTCAAGATAACACAGAAAAGG + Intergenic
1043030178 8:75124546-75124568 AATGCAGGGACACAAAGAACTGG + Intergenic
1043045206 8:75314497-75314519 AGTGCTGGACCACACAGATAGGG - Intergenic
1043242284 8:77950000-77950022 AGTGCAGGACCATACAGCAATGG + Intergenic
1044265543 8:90177244-90177266 AATGGAGGCACACACAGAACTGG + Intergenic
1045070892 8:98503688-98503710 ACTGCACAACTACACAGAAACGG - Intronic
1045733224 8:105265984-105266006 AATTCAAGACAACACAGACAAGG - Intronic
1045881648 8:107047458-107047480 ATTGCAGGAGCAGACAGCAATGG + Intergenic
1046872661 8:119220792-119220814 ACTGCAGGTCCACACAGCAAGGG - Intronic
1047456317 8:125016502-125016524 AATTCAAGACAACACAGAGAAGG - Intronic
1047891261 8:129313662-129313684 AGATCAGGCCCACACAGAAAAGG - Intergenic
1050113961 9:2243777-2243799 AATGAATAACCACACTGAAAGGG + Intergenic
1050248333 9:3714828-3714850 AATTCAGGATAACACAGAGAAGG + Intergenic
1050276154 9:4002830-4002852 AAAGCAGGAAGACAGAGAAATGG - Intronic
1050759044 9:9043457-9043479 ACTGAAGGACAAAACAGAAAAGG - Intronic
1050994711 9:12201815-12201837 AATGCAGGAAAATACATAAAAGG + Intergenic
1051367291 9:16330036-16330058 AAGGCCTGACCACACGGAAATGG + Intergenic
1052036517 9:23687390-23687412 AATGCTGAGCCACACAGAAGTGG - Intergenic
1052476986 9:28972397-28972419 AATTCAGGATAACACAGAGAAGG + Intergenic
1053015844 9:34661618-34661640 AATACAGGGTCTCACAGAAATGG - Exonic
1053053933 9:34982581-34982603 AATGGGAAACCACACAGAAATGG - Intergenic
1053438876 9:38096834-38096856 AATGGAGGCCCAGAAAGAAAAGG + Intergenic
1053591277 9:39517106-39517128 AAGGCAGGACCACAGTGAAAGGG + Intergenic
1053849121 9:42272463-42272485 AAGGCAGGACCACAGTGAAAGGG + Intergenic
1054575031 9:66848187-66848209 AAGGCAGGACCACAGTGAAAGGG - Intergenic
1055496126 9:76857429-76857451 AATGGTGGACCAGACAGAAAGGG + Intronic
1056007467 9:82287239-82287261 AATGCAAGATAACACTGAAAAGG + Intergenic
1056200988 9:84276498-84276520 AATGCATGTCCACAGAGGAATGG + Exonic
1057513077 9:95697120-95697142 AAAGCAGGAACAAAAAGAAATGG - Intergenic
1058693931 9:107543302-107543324 AATGCTGGACCCAACACAAAAGG - Intergenic
1058992271 9:110266147-110266169 CATGATGAACCACACAGAAAAGG + Intergenic
1059537588 9:115097017-115097039 AGTGCAGGACAGCAGAGAAACGG - Intronic
1059867748 9:118535592-118535614 AATGCAGCTCCACAAACAAAAGG - Intergenic
1060328851 9:122645030-122645052 AATTCAAGAAAACACAGAAAAGG + Intergenic
1061721664 9:132555753-132555775 CATGCAGGACCACACAGGGCTGG - Intronic
1187610110 X:20933459-20933481 AATTCTGCACCACCCAGAAATGG + Intergenic
1188864776 X:35301164-35301186 AACTCAAGACAACACAGAAAAGG + Intergenic
1189131492 X:38502688-38502710 AGTGCAGAAGCACAGAGAAAAGG - Intronic
1189874200 X:45419291-45419313 AATTCAAGATAACACAGAAAAGG - Intergenic
1191732269 X:64349672-64349694 AAAGCTGGATCCCACAGAAAAGG + Intronic
1191812014 X:65199385-65199407 AATTCAAGATAACACAGAAAAGG - Intergenic
1191994635 X:67079765-67079787 AATTCAAGATAACACAGAAAAGG - Intergenic
1192397460 X:70796096-70796118 AATTCAGGATAACACAGAGAAGG + Intronic
1192612398 X:72580203-72580225 AATGCAGAATAACCCAGAAATGG - Exonic
1192958634 X:76103045-76103067 AATTCAAGATAACACAGAAAAGG - Intergenic
1193009416 X:76659286-76659308 AATTCAAGATAACACAGAAAAGG + Intergenic
1193289193 X:79752128-79752150 AATTCAAGACTACACAGAGAAGG - Intergenic
1194530863 X:95046415-95046437 AATTCAAGACCACACAGAGAAGG + Intergenic
1194892397 X:99397075-99397097 AATTCAAGATCACACAGAGAAGG - Intergenic
1196096573 X:111807465-111807487 AATTCAAGATAACACAGAAAAGG - Intronic
1196269919 X:113698590-113698612 AATTCAAGATAACACAGAAAAGG - Intergenic
1197708738 X:129651856-129651878 CATGCAGGACCACAGAGCAGTGG - Intronic
1198841177 X:140859660-140859682 AATTCAAGACAACACAGAGAAGG + Intergenic
1199223294 X:145341618-145341640 AATTCAAGATAACACAGAAAAGG + Intergenic
1199457237 X:148043141-148043163 AATGCAAGATAACACAGAGAAGG - Intergenic
1200930746 Y:8694782-8694804 AAAGCAGAGCCACACAGACAGGG + Intergenic
1202104869 Y:21352966-21352988 AATGCAGGACCCCATTTAAATGG + Intergenic