ID: 953650900

View in Genome Browser
Species Human (GRCh38)
Location 3:44802719-44802741
Sequence GTGCATACCTAGTTTTCTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 111}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953650898_953650900 -8 Left 953650898 3:44802704-44802726 CCACCAGTAGTGCATGTGCATAC 0: 1
1: 0
2: 0
3: 14
4: 213
Right 953650900 3:44802719-44802741 GTGCATACCTAGTTTTCTAATGG 0: 1
1: 0
2: 0
3: 8
4: 111
953650897_953650900 14 Left 953650897 3:44802682-44802704 CCATGGTGGTTGCAGAAGGGTAC 0: 1
1: 0
2: 0
3: 8
4: 101
Right 953650900 3:44802719-44802741 GTGCATACCTAGTTTTCTAATGG 0: 1
1: 0
2: 0
3: 8
4: 111
953650894_953650900 26 Left 953650894 3:44802670-44802692 CCAAGTTGCTTTCCATGGTGGTT 0: 1
1: 0
2: 15
3: 129
4: 1151
Right 953650900 3:44802719-44802741 GTGCATACCTAGTTTTCTAATGG 0: 1
1: 0
2: 0
3: 8
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953650900 Original CRISPR GTGCATACCTAGTTTTCTAA TGG Intronic
909099603 1:71333753-71333775 GTGCTTACCTAGCTATCTATGGG - Intergenic
911765486 1:101669527-101669549 TTGCATGCCTATTTTTCTATAGG - Intergenic
919528727 1:198687806-198687828 GTGCATACCTTATTTCCTTAGGG + Intronic
921823538 1:219645099-219645121 TTCTATACCTAGTTTTCTGAAGG - Intergenic
924241222 1:242042969-242042991 TTCCATACCCAGTTTTCAAAGGG - Intergenic
1062765404 10:59099-59121 TTCCATACCCAGTTTTCAAAGGG + Intergenic
1063831363 10:9957426-9957448 GTGTAAACTTAGTTTTGTAAAGG - Intergenic
1064902525 10:20310806-20310828 GTAAATATCTAGGTTTCTAATGG - Intergenic
1065293907 10:24257210-24257232 GTTTCTACCTGGTTTTCTAATGG + Intronic
1080426141 11:32156105-32156127 GTGTATTTCTAGTCTTCTAATGG + Intergenic
1082834529 11:57641861-57641883 GTGCATTCCTTTTTTTCTCAAGG - Intergenic
1086236713 11:84640250-84640272 GTGCAGACCTCGTCTTGTAATGG - Intronic
1086879784 11:92139613-92139635 TTGCAGGCCTAGTTTTCTAATGG + Intergenic
1086990819 11:93302509-93302531 TTCCATACCCAGTTTTTTAAGGG - Intergenic
1088474598 11:110222294-110222316 ATGCAAACCTACTTTTCCAAAGG + Intronic
1093040343 12:14371865-14371887 CTGCATACCTTGTTTTTCAAGGG + Intronic
1095101408 12:38188791-38188813 TTTCATACCCAGTTTTCAAAGGG - Intergenic
1095581767 12:43808110-43808132 CTGCATACATTGTTTTCAAATGG - Intergenic
1096260879 12:50090434-50090456 GAGCATAACTAGTGTTCTAATGG - Intronic
1096562823 12:52449161-52449183 CTGCCTGCCTAGTTTTCTTAGGG + Intronic
1097606925 12:61766867-61766889 GTGCTTAACTTTTTTTCTAATGG + Intronic
1099366206 12:81767614-81767636 GTGCATTTCTGGTTTTCTGAAGG + Intergenic
1100107868 12:91199289-91199311 GTGGATACCTAGTTTTTCCAAGG + Intergenic
1102323050 12:111955463-111955485 GTGCAGAGCTAGTCATCTAAGGG + Intronic
1105829566 13:24151984-24152006 GGGAATGCCTGGTTTTCTAAAGG + Intronic
1106663444 13:31826551-31826573 TTGCATTCCTATTTTTCTGATGG + Intergenic
1110943354 13:81381262-81381284 TTGCATACATAGTTATCTGAAGG - Intergenic
1112711408 13:102133185-102133207 GTGCAGACCTAGAATTATAATGG - Intronic
1112944288 13:104907411-104907433 TTCTATACCCAGTTTTCTAAGGG + Intergenic
1113233979 13:108248598-108248620 GTCTATTCCTAGTTTTTTAACGG - Intergenic
1118263760 14:64273480-64273502 GTCTATACCCAGTTTTTTAAGGG + Intronic
1123962260 15:25416098-25416120 GTGTATACTCAGTTTTTTAAAGG - Intronic
1124433390 15:29626826-29626848 CTTCATACCTAGTTTGCTGAGGG + Intergenic
1125276652 15:37999701-37999723 TTCCATACCCAGTTTTTTAAGGG + Intergenic
1126491366 15:49240509-49240531 GTGGATAAGTAGTTTTCTATGGG + Intronic
1127493566 15:59488237-59488259 TTGTATACCTAGTTTTTTGAGGG - Intronic
1128527137 15:68420267-68420289 GTGAAAACCTAGTTATATAATGG - Intronic
1140736447 16:77902131-77902153 GTGTATGCTTTGTTTTCTAATGG - Intronic
1144049738 17:11488209-11488231 GTGCACACCGAGATTTCTCAGGG - Intronic
1144212169 17:13024820-13024842 GGGCATTCCTAGTTATTTAAGGG - Intergenic
1147704040 17:42413775-42413797 GTGGATAAGGAGTTTTCTAAGGG + Intronic
1164181930 19:22826738-22826760 GTTCATTCACAGTTTTCTAATGG + Intergenic
1167718575 19:51161125-51161147 GTGCTCACAGAGTTTTCTAATGG + Intergenic
932016060 2:68027541-68027563 GTGTATATCTAGTATTCTTATGG - Intergenic
937801012 2:126080219-126080241 GGGAATAACTAGTTTTCTAATGG + Intergenic
940116337 2:150212707-150212729 ATGAAGATCTAGTTTTCTAATGG + Intergenic
941343329 2:164335636-164335658 CTGCAAATCTAGTTCTCTAACGG + Intergenic
941527412 2:166623344-166623366 TTCTATACCTAGTTTTTTAAGGG + Intergenic
943317645 2:186410116-186410138 GTGCATTTCTAGTTGTATAAAGG - Intergenic
945590326 2:211721042-211721064 TTGCATACCCAGATTTCCAAAGG - Intronic
948687806 2:239680332-239680354 GTGCAGTCCTATTTTCCTAAGGG + Intergenic
948723789 2:239919726-239919748 GAGAATACCTCGTTTTCCAAAGG + Intronic
1169419919 20:5451787-5451809 GTGCCTTCCTGGTTTTCAAATGG + Intergenic
1169511522 20:6269182-6269204 TTTCAAACCTAGTTTTCTAAAGG - Intergenic
1171520464 20:25771266-25771288 GTGGATACCTAGGTTTCGGATGG + Intronic
1171556455 20:26085227-26085249 GTGGATACCTAGGTTTCGGATGG - Intergenic
1171818878 20:29814431-29814453 TTCCATACCCAGTTTTCAAAGGG + Intergenic
1171898935 20:30838774-30838796 TTCCATACCCAGTTTTCAAAGGG - Intergenic
1177189528 21:17834705-17834727 GTGATTACCAAGTTCTCTAATGG + Intergenic
1177714862 21:24826451-24826473 GTGCAAACCCAGTACTCTAAGGG - Intergenic
1178212922 21:30558380-30558402 GGGCATGGCCAGTTTTCTAAAGG + Intronic
1178270786 21:31187880-31187902 GTGAATACCTACTTTGCTAAGGG + Intronic
949096185 3:88657-88679 TTGCATAAGTAGTTTTCCAAGGG - Intergenic
951403719 3:22268017-22268039 GTGCATACTTACTTTGCAAAAGG - Intronic
952066065 3:29572441-29572463 GTCTATACCTAGTTTTTTGAGGG + Intronic
952082049 3:29771344-29771366 GTGCAGTCCTTGTTTTCAAAGGG - Intronic
953091226 3:39727719-39727741 TTTCAAACCTAGTTTTCTAAAGG + Intergenic
953650900 3:44802719-44802741 GTGCATACCTAGTTTTCTAATGG + Intronic
957087609 3:75696996-75697018 TTCCATACCCAGTTTTCAAAGGG - Intergenic
957966469 3:87327823-87327845 TTCTATACCTAGTTTTTTAAGGG - Intergenic
960247985 3:115420756-115420778 GTGCATATCTATTTCTCTCAGGG - Intergenic
962790206 3:138804724-138804746 GGCCATACTGAGTTTTCTAAAGG - Intronic
974746071 4:66078154-66078176 GTGAATATCCAGTTTTCTCAAGG - Intergenic
974749954 4:66125997-66126019 ATGGCTGCCTAGTTTTCTAAAGG - Intergenic
977712879 4:100147608-100147630 GTGCATACAATGTTTTCTGATGG - Intergenic
981716878 4:147760577-147760599 GTCCATACCTGGTGTTCTGATGG + Intronic
981717072 4:147762320-147762342 TGGCATACCTAGATTTCAAAAGG - Intronic
989730964 5:44648129-44648151 GTGCAGTTCTAGTTTCCTAATGG + Intergenic
991390942 5:66143004-66143026 GTGGACACCTATTTTTCAAATGG - Intronic
993895921 5:93534098-93534120 TTGTATACTTTGTTTTCTAAAGG - Intergenic
994180859 5:96764808-96764830 TTTCATATCCAGTTTTCTAATGG + Intronic
995342634 5:111076831-111076853 TTGCACACATACTTTTCTAAGGG + Intronic
995348306 5:111146422-111146444 TTGCAAACCTAATTTTCTATTGG - Intergenic
997504847 5:134409016-134409038 GGGCTTACCTATGTTTCTAAGGG + Intronic
999370813 5:151054139-151054161 GTGGATGCCTCGTATTCTAAAGG + Intronic
1000005017 5:157175490-157175512 TTTCATGCCTTGTTTTCTAAAGG - Intronic
1000698386 5:164418222-164418244 GTGCATAGAGATTTTTCTAATGG + Intergenic
1000951241 5:167485870-167485892 ATGCATACCTAGGTTTGTATAGG - Intronic
1003389609 6:5702315-5702337 GAGCATATATAGTTTGCTAAAGG - Intronic
1003442368 6:6155102-6155124 GTCCATACATGGTTTTCTAGGGG + Intronic
1004959261 6:20767982-20768004 GTGCATACTTAGTTATAAAATGG - Intronic
1005245084 6:23874515-23874537 GTGAATATCTTGTTTTCTGAAGG - Intergenic
1007164487 6:39819329-39819351 GGGCAAACCTAGTCTTCAAAGGG + Intronic
1007317274 6:40999565-40999587 GTGCATACCACGTTTGTTAAGGG - Intergenic
1008640708 6:53459605-53459627 TTGAATACCTAGTTTTCTGAGGG - Intergenic
1010831687 6:80538969-80538991 GTGAAAATGTAGTTTTCTAAAGG - Intergenic
1011938889 6:92817754-92817776 GTGCTTACCTAGTTCTGTATAGG - Intergenic
1012980919 6:105830082-105830104 GTCCATACGTAATATTCTAATGG + Intergenic
1013257294 6:108400364-108400386 TTCTATACCTAGTTTTCTGAGGG + Intronic
1020528051 7:9289516-9289538 ATGCATACCCAGTTTTCTCAGGG + Intergenic
1023008398 7:35900884-35900906 GAGCATGCCTAATTCTCTAATGG - Intronic
1023016078 7:35969363-35969385 GAGCATGCCTAATTCTCTAATGG - Intergenic
1035013199 7:155739465-155739487 CTGCATACCTAGTTTTCCTTAGG + Intronic
1042771178 8:72384312-72384334 CTGAATATTTAGTTTTCTAAAGG - Intergenic
1051286183 9:15499443-15499465 GTGCATTCCAATTTTCCTAATGG + Intronic
1056492598 9:87122172-87122194 GTGCACCCCTAGTTGTGTAAAGG - Intergenic
1057948961 9:99354431-99354453 GTGCAAACCTAGGGTTCTCAGGG - Intergenic
1058498416 9:105585617-105585639 ATGCATCCTCAGTTTTCTAATGG + Intronic
1062739847 9:138165158-138165180 TTCCATACCCAGTTTTCAAAGGG - Intergenic
1203370544 Un_KI270442v1:299699-299721 TTCCATACCCAGTTTTCAAATGG + Intergenic
1185495132 X:549005-549027 GTGCCTATCTAGTTTTTAAAAGG - Intergenic
1187171472 X:16856143-16856165 TTGAATACCTATTTCTCTAAAGG + Intronic
1193664869 X:84303448-84303470 TTCCATACCCAGTTTTCTGAGGG - Intergenic
1194196420 X:90899162-90899184 CTCTATACCTAGTTTTCTGATGG + Intergenic
1194875783 X:99186254-99186276 GTGTTTCCCTAGTTTTCTAGAGG + Intergenic
1196162424 X:112500463-112500485 GTTCATACCCAGTTTTTTGAGGG + Intergenic
1200542264 Y:4473362-4473384 CTCTATACCTAGTTTTCTGATGG + Intergenic
1200900757 Y:8429542-8429564 TTGCATAGGTACTTTTCTAAGGG - Intergenic
1201760546 Y:17532376-17532398 TTCCATACCCAGTTTTCAAAGGG + Intergenic
1201841008 Y:18373614-18373636 TTCCATACCCAGTTTTCAAAGGG - Intergenic