ID: 953655400

View in Genome Browser
Species Human (GRCh38)
Location 3:44847882-44847904
Sequence CATTATATGCAGCAATGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953655400 Original CRISPR CATTATATGCAGCAATGCCA AGG (reversed) Intronic
901582125 1:10253130-10253152 CCCTATATGCAGCATTGTCAAGG - Intronic
908280678 1:62531732-62531754 GATTATATGCAGCATTGTCTTGG - Intronic
909732054 1:78904323-78904345 CTTTAAATGCAGCAATTCAAAGG - Intronic
911340845 1:96634360-96634382 CATTATATTCTGGAATCCCAGGG - Intergenic
912654656 1:111475504-111475526 AAGTTTATGTAGCAATGCCAGGG + Intronic
913498849 1:119452270-119452292 CCTGATTTGCAGCAATGGCAGGG + Intergenic
915613492 1:157015326-157015348 CATTATACGCAGCTATGAAATGG + Intronic
916196469 1:162228354-162228376 CTTTCTAGGCATCAATGCCACGG - Intronic
920776512 1:208943403-208943425 CTTTATAAGCAGAAATGTCAAGG - Intergenic
1063099276 10:2935389-2935411 TATTATTTGCAGCAATACAAGGG + Intergenic
1069907667 10:71741276-71741298 CATGATACCCAGCAATGCCAGGG - Intronic
1072177735 10:92945438-92945460 CATTATCTAGACCAATGCCATGG + Intronic
1073923824 10:108490178-108490200 AATAATATGCAACAAAGCCAAGG - Intergenic
1076079417 10:127565323-127565345 CAATATCTGCAGCAATGCAGAGG - Intergenic
1076517827 10:131059038-131059060 AATACTATGCAGCAATGCAAAGG + Intergenic
1078780033 11:14429437-14429459 CAAGATATGCAGAAATTCCATGG - Intergenic
1083068507 11:59950645-59950667 CATTAGATCCAGCAATGTGAGGG + Intergenic
1088836543 11:113582575-113582597 CTCTATATGCAGCATTCCCATGG + Intergenic
1096014988 12:48263032-48263054 CATTTTATCCAACAATTCCAGGG - Intergenic
1096909527 12:54968346-54968368 CATGATATTCAGCAATAACATGG - Intronic
1099152602 12:79133579-79133601 CATTAGAGGTAGCAATGCCAAGG - Intronic
1108428712 13:50332334-50332356 AATCATATTCAGCAATGACAGGG - Intronic
1109185192 13:59259796-59259818 CATACCATGCAGCTATGCCAAGG + Intergenic
1109366193 13:61359171-61359193 CATTGTTTGTGGCAATGCCATGG + Intergenic
1109856835 13:68141333-68141355 CATTATATGCAGAAATGACATGG + Intergenic
1110469918 13:75847922-75847944 CATTTTAAGCTGCACTGCCATGG + Intronic
1110708235 13:78620320-78620342 CACTAAATGAAGCTATGCCAAGG + Intronic
1111577712 13:90179915-90179937 CATTTTATGCATGGATGCCATGG + Intergenic
1115967649 14:38910477-38910499 CATTAAAAGCAACAATGGCAAGG + Intergenic
1116438300 14:44920215-44920237 CATTATATACAAGAATGGCAGGG - Intergenic
1116647625 14:47549556-47549578 CATAATAGTCAGCAAAGCCAAGG - Intronic
1118169200 14:63369449-63369471 AATTTTATGCAGAAATGCAAAGG + Intergenic
1122105358 14:99449452-99449474 CATTTTATGCAAGAATACCATGG - Intronic
1129034468 15:72641114-72641136 CTTTATCTCCAGCTATGCCATGG - Intergenic
1129215414 15:74096102-74096124 CTTTATCTCCAGCTATGCCATGG + Intergenic
1134875732 16:17697070-17697092 CACTCCATGCAGGAATGCCAAGG + Intergenic
1142052529 16:87968126-87968148 TTTTAAATGCACCAATGCCAAGG + Intronic
1142501094 17:333644-333666 GATTATATGCAGCACTGAAATGG + Intronic
1143994502 17:10994941-10994963 TATAAACTGCAGCAATGCCAGGG + Intergenic
1150791320 17:68201767-68201789 TCTTACATGCAACAATGCCAAGG - Intergenic
1158742539 18:60159865-60159887 CAGCAGATGCAGGAATGCCATGG + Intergenic
1160186227 18:76678709-76678731 CAATAAATGCAGCAATAACATGG + Intergenic
1160336402 18:78044103-78044125 AATAATATCCAGCCATGCCATGG - Intergenic
926879760 2:17531521-17531543 CATTATATGGATCATTGGCAAGG + Intergenic
929919611 2:46162981-46163003 CAGTATGTGCATCACTGCCATGG - Intronic
930723131 2:54657065-54657087 CATTTCATGCAGCAAAGCCTGGG - Intronic
932967724 2:76497177-76497199 CATTATATGCAGATATTTCAGGG - Intergenic
934138802 2:89024281-89024303 CATTGTAAGGAGCAATACCAAGG - Intergenic
934230446 2:90176276-90176298 CATTGTAAGGAGCAATACCAAGG + Intergenic
934754903 2:96817989-96818011 CCTTATCTGCAGTAACGCCAGGG - Intronic
935393671 2:102581920-102581942 AATTATATGCTGCAGTGCCTGGG + Intergenic
937967040 2:127520465-127520487 CATTAAATGAAGCAGTGCAAAGG - Intronic
938035603 2:128032406-128032428 CTTTCTCTGCTGCAATGCCACGG + Intergenic
938402267 2:131003732-131003754 CCTGAAATGCAGAAATGCCAGGG + Intronic
938857907 2:135334532-135334554 CATTAAATGCAACAATGCTGAGG + Intronic
940120021 2:150253938-150253960 CCTTATATGCAGCTCTTCCAGGG - Intergenic
940904488 2:159156963-159156985 TATGACATGCAGCAAGGCCAGGG - Intronic
941169550 2:162119954-162119976 CAAGAGATGCAGCAATGACAGGG - Intergenic
943927287 2:193801306-193801328 CAAGATGTGCAGAAATGCCATGG + Intergenic
944635825 2:201675137-201675159 CTTTATTTACTGCAATGCCATGG + Intronic
945865771 2:215173294-215173316 CAATATCTGAAGCAATCCCAAGG - Intergenic
1170665929 20:18385864-18385886 CATATTTTGCTGCAATGCCAGGG + Intronic
1176894607 21:14361725-14361747 CATTATATGCAGTAATTCCATGG - Intergenic
1177069648 21:16487807-16487829 AATTATATACAGCAATGTCAAGG - Intergenic
1181120543 22:20665406-20665428 CATTATACTCAGCAATGAGAGGG - Intergenic
1182922264 22:34090769-34090791 CATTACATGAAGCAAGGCAAAGG + Intergenic
1183499485 22:38169826-38169848 CATTATAGGCAGTAATGCCCTGG + Intronic
953655400 3:44847882-44847904 CATTATATGCAGCAATGCCAAGG - Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956679288 3:71762891-71762913 CATTTTAAGTTGCAATGCCAAGG + Intergenic
959102071 3:102022122-102022144 TATTATAAGCAGAAATGCAAAGG - Intergenic
959865619 3:111266718-111266740 CCTGATTTGCAGCAGTGCCAAGG - Intronic
962441017 3:135416233-135416255 CATCATAGGCACCAGTGCCAGGG - Intergenic
963479854 3:145858168-145858190 GATTAGATGAAGCAATGCCTTGG + Intergenic
965439198 3:168691940-168691962 CATAATCTGCAGAAATACCAGGG + Intergenic
966824602 3:183953164-183953186 CATAATAACCAGGAATGCCAAGG + Exonic
970761041 4:19487058-19487080 CATTATAAGCAGGAACGGCAAGG + Intergenic
972207131 4:36787734-36787756 CATTATATAAATCTATGCCAAGG + Intergenic
973322778 4:48826920-48826942 CATTACATGCAGCAATAAAAAGG - Intronic
976149832 4:82080670-82080692 GCTTATATGAAGCAGTGCCAAGG - Intergenic
977557541 4:98500374-98500396 CATCATCTACAGCAAAGCCAAGG + Intronic
978737257 4:112098028-112098050 CTTTATCAGCAGCAAGGCCAAGG - Intergenic
979885037 4:126016559-126016581 CAAGATATGCAGAAATGACAGGG - Intergenic
981227432 4:142313404-142313426 CATTTTATGAAGCAGTGCCAGGG + Intronic
982411600 4:155084069-155084091 AATTATAAGCAGCAATGTCCAGG + Intergenic
982960514 4:161829864-161829886 GATTGTATGCATCAATGACAAGG + Intronic
983148645 4:164248317-164248339 AAATATATGCACCAATCCCAAGG + Intronic
983763792 4:171450644-171450666 CATTATGTGCAGAAATCACAAGG - Intergenic
984227005 4:177047097-177047119 CTTGATAGGCAGCAAAGCCAAGG + Intergenic
984680693 4:182605866-182605888 CAGTTTATGCTGCAATTCCAGGG - Intronic
984773039 4:183454799-183454821 CACTATATACAGCAATCACAGGG - Intergenic
989439098 5:41449115-41449137 AATAATATACAGAAATGCCAAGG - Intronic
990565799 5:57027416-57027438 CAGTTTATTCAGCATTGCCAAGG + Intergenic
994870780 5:105347741-105347763 CATTATAGGCAGCAATTCCAAGG - Intergenic
995631452 5:114137586-114137608 TTTTATATGCAGAAATGGCATGG + Intergenic
997082620 5:130758492-130758514 TATTATATAGAGTAATGCCATGG - Intergenic
998685581 5:144520618-144520640 AATTATATGCAGAAATTCCTAGG - Intergenic
998693164 5:144610616-144610638 ATTTATATGCAACAATGGCATGG - Intergenic
1010584818 6:77644547-77644569 CATTTTAAGCAGCAAAGTCAAGG - Intergenic
1011011762 6:82711286-82711308 CATTAAAAGCAGCATTCCCAGGG + Intergenic
1013551733 6:111214497-111214519 CCTTATATGCAGGGATGCCTGGG - Intronic
1014396902 6:120935031-120935053 CATTCTATTCAGCAAAGCTATGG - Intergenic
1019869407 7:3745090-3745112 GATTAAATTCAGCAATGGCAGGG - Intronic
1021564034 7:21999242-21999264 CATTTTTCGCAGGAATGCCATGG - Intergenic
1023371271 7:39514488-39514510 TATTTTATGTAGCCATGCCAGGG - Intergenic
1023926724 7:44674947-44674969 TAGAAGATGCAGCAATGCCATGG - Intronic
1028812191 7:95100637-95100659 CACTATAAGCAGCCATGCCTAGG + Intronic
1030567803 7:111182096-111182118 CATTTTATGTATCAATTCCATGG - Intronic
1043533897 8:81179060-81179082 CACAATATGGAGCAATGGCAAGG + Intergenic
1045137793 8:99241013-99241035 CCTTATTTGCAGCACTGCCAGGG - Intronic
1046518274 8:115291869-115291891 CCTTTTGTGCAGGAATGCCAAGG + Intergenic
1047119994 8:121891854-121891876 ACTTAAATGAAGCAATGCCAGGG + Intergenic
1047769376 8:128018410-128018432 CATTACATGCAGCAATGAAGGGG - Intergenic
1047880514 8:129187395-129187417 CATTATGTGGAGCAATCGCAGGG - Intergenic
1049487493 8:142874184-142874206 CAGGCTAAGCAGCAATGCCAGGG - Exonic
1052772056 9:32698933-32698955 CATTTTATTTACCAATGCCAGGG + Intergenic
1053492641 9:38521536-38521558 TATTATATGAAGCAATGGAAAGG + Intergenic
1054885542 9:70194047-70194069 CATCATATGTAGCAATTCCAAGG + Intronic
1055292483 9:74797227-74797249 CATTATATTCAACATTGCCTTGG - Intronic
1056640972 9:88370257-88370279 TATTATCTGCTGGAATGCCAAGG + Intergenic
1057672875 9:97110471-97110493 TATTATATGAAGCAATGGAAAGG + Intergenic
1187817497 X:23248646-23248668 CAATATATGTAGCAATAGCATGG + Intergenic
1189631574 X:42960030-42960052 CTTTCTTTACAGCAATGCCATGG - Intergenic
1191933395 X:66399287-66399309 CATTAGACCCAGCAATCCCATGG - Intergenic
1192033409 X:67539148-67539170 CATTATAAGCATCTATGCAAAGG + Intergenic
1193917876 X:87388312-87388334 CATTATGAGAATCAATGCCAAGG - Intergenic
1194004842 X:88477615-88477637 CATTTTATGTAGCAAAACCAGGG - Intergenic
1195140937 X:101959182-101959204 CTTTTTTTGCTGCAATGCCATGG - Intergenic
1196598939 X:117578777-117578799 CATTTGATCCAGCAATCCCATGG - Intergenic
1196907845 X:120455528-120455550 CATTATATGTCACAGTGCCATGG + Exonic
1198549999 X:137735360-137735382 CATGGTATGCAGCTATGTCATGG - Intergenic
1199639670 X:149847984-149848006 CATCAAATGCAGCGATGCCCAGG - Intergenic
1201451182 Y:14116406-14116428 CATTACATGCAGCAATGTGAAGG - Intergenic