ID: 953657047

View in Genome Browser
Species Human (GRCh38)
Location 3:44862191-44862213
Sequence TGCGGGGCCCGCGGGGCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 243}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953657040_953657047 -1 Left 953657040 3:44862169-44862191 CCGCTGGGCGGAGGAGGGGCGCT 0: 1
1: 0
2: 1
3: 19
4: 178
Right 953657047 3:44862191-44862213 TGCGGGGCCCGCGGGGCTCTTGG 0: 1
1: 0
2: 3
3: 27
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953657047 Original CRISPR TGCGGGGCCCGCGGGGCTCT TGG Intronic
900097247 1:944967-944989 GGCGGGGGGCGTGGGGCTCTGGG - Intronic
900190198 1:1349895-1349917 TCCGGGGCTCGCGGGGCTGGAGG + Intergenic
900387423 1:2416925-2416947 TGGGGGGGCCCTGGGGCTCTGGG + Intergenic
900396647 1:2455779-2455801 TGGAGGGCCCGAGGGGCTCCCGG - Intronic
900411575 1:2514926-2514948 TGCCGGGGACGAGGGGCTCTGGG + Intronic
900481401 1:2901192-2901214 TGCAGGCCGCACGGGGCTCTGGG + Intergenic
900518915 1:3096311-3096333 GAAGGGGCCCGCGGGGTTCTGGG - Intronic
900581634 1:3412563-3412585 TGCGGGGGCCGAGGGGCCCTTGG - Exonic
900952588 1:5866196-5866218 TTCAGGGCCCGCAGGGGTCTAGG - Intronic
901045305 1:6392755-6392777 CGAGGGGCTCGCGCGGCTCTGGG + Intronic
901193284 1:7425326-7425348 CTGGGGGCCAGCGGGGCTCTTGG + Intronic
901243046 1:7705641-7705663 GGCGGGGCCCGCGGAGCTCCCGG + Intronic
901332769 1:8423731-8423753 CGCGGGGCCCGGGGGGCGCGGGG + Intronic
902409898 1:16206575-16206597 TGGGGGGTGGGCGGGGCTCTGGG - Intronic
904044912 1:27603256-27603278 TGCGGTGCCCGCGGTGCGATCGG - Intronic
904045188 1:27604287-27604309 CGCGGGGTCCCCGGGGCTCCTGG - Intronic
905734843 1:40317612-40317634 TGCAGAGCCCGAGGTGCTCTCGG - Intronic
909698184 1:78491028-78491050 TGCGGGGCGCGCGCGGCTCCTGG - Intronic
914900003 1:151706712-151706734 CACGGGGGCCGCGGGGCTCTGGG + Exonic
917027765 1:170661612-170661634 TGCGGCGCTGGCAGGGCTCTGGG + Intergenic
919407340 1:197201356-197201378 TGCGGAGGCGGCGGAGCTCTGGG - Intergenic
922950987 1:229558472-229558494 CGCGGGGCCCGCGCTGCTCTGGG - Exonic
924511151 1:244730191-244730213 TGCGGGTGCCGCGGAGCCCTGGG - Intergenic
1063664701 10:8054426-8054448 GGCGAGGCCCGCGGGGCTTGGGG - Intronic
1063664862 10:8055142-8055164 CGCGGAGCCCGCAGGGCTCTCGG - Intronic
1064208786 10:13347272-13347294 TGCGGGGCCGGCGGGGAGGTAGG - Intronic
1067173908 10:43929237-43929259 TGCAGTGCCCCGGGGGCTCTGGG + Intergenic
1069438350 10:68406710-68406732 TGGGGGGCCCCCAGGCCTCTGGG - Intronic
1069695514 10:70382635-70382657 GGCGGGGCGCGCGGGGCTGCGGG + Intronic
1070923878 10:80205463-80205485 CGCGGGGCCCGCGGGGCACTCGG + Exonic
1070923884 10:80205472-80205494 CGCGGGGCACTCGGGGCACTGGG + Exonic
1073125537 10:101146656-101146678 TGCGGTGCCCTCGGAGCCCTGGG - Intergenic
1073178519 10:101570443-101570465 TGCGGGGCCTGCCGGGCTGCGGG - Intergenic
1073207296 10:101775920-101775942 GGCGTGACCCGCCGGGCTCTCGG - Exonic
1075334439 10:121598272-121598294 CTCGGGGCCCCCGGGGCTCGCGG + Exonic
1075381076 10:122019101-122019123 TGCGGGGCCGGAGGGTCTTTGGG + Intronic
1076190899 10:128482747-128482769 TGCGGGGGCCTTGAGGCTCTAGG - Intergenic
1076372511 10:129964454-129964476 GGCGGGGCTCGCGGGGCTCGCGG - Intergenic
1076887535 10:133269531-133269553 TGCGGGGACGGCTGGGCTCAGGG + Intronic
1077060312 11:615032-615054 TGCCGGGCCCGCGGGGTCCTAGG + Intronic
1077581854 11:3422360-3422382 GGAGAGGCCCGCGGGGCTCGCGG - Intergenic
1077889894 11:6411285-6411307 TGCGGGGCCTCCGTGGCTGTTGG + Exonic
1078090781 11:8263204-8263226 TGCGGGGCGGGCGGCGCGCTGGG - Intronic
1078190747 11:9091294-9091316 AGCCGGGCGCGCGGGGCTCGGGG - Intronic
1079126460 11:17721327-17721349 GGCGGGCGCCGCAGGGCTCTCGG - Exonic
1079353429 11:19712527-19712549 AGCCGTGCCCGCGTGGCTCTGGG + Intronic
1084070167 11:66728466-66728488 CGGCGGCCCCGCGGGGCTCTGGG + Intronic
1084112603 11:67023555-67023577 CGCGGAGTGCGCGGGGCTCTGGG - Intronic
1084238763 11:67805177-67805199 GGAGAGGCCCGCGGGGCTCGCGG - Intergenic
1084296183 11:68214326-68214348 GGCGGGGCCCGCGGGGGGCCAGG - Intergenic
1085229032 11:74948999-74949021 TGCGAGCCCCCCGGGGATCTCGG + Exonic
1087114692 11:94512622-94512644 TGCGGGGCGCGCGGGGAACCCGG + Intergenic
1088173186 11:107019163-107019185 GGCGGGGTGCGCGGGGCTCCCGG + Intergenic
1088868935 11:113875364-113875386 TGCGGGGCCTGCAGGGCTGCGGG - Intronic
1089590008 11:119533989-119534011 TGCGGCGCACGCCCGGCTCTCGG + Intergenic
1091752847 12:3033395-3033417 TGCTGGACTTGCGGGGCTCTGGG - Intronic
1092409452 12:8242809-8242831 GGAGAGGCCCGCGGGGCTCGCGG - Intergenic
1094682733 12:32679826-32679848 TGGGGGACGCGCGGGGCACTCGG + Intronic
1094849600 12:34376477-34376499 TGCGGGGCCCAGGGGACCCTGGG - Intergenic
1094872668 12:34606885-34606907 TGCGGGGCCCAGGGGACTCTGGG + Intergenic
1095958499 12:47819629-47819651 GGCTGGGCCCGCGGGGCTGGCGG + Intronic
1095982429 12:47981032-47981054 GGCAGGGCCCAAGGGGCTCTTGG - Intronic
1097245340 12:57604888-57604910 AGCGGGGCCCGGGGGGCGCGCGG - Intronic
1098024719 12:66189470-66189492 AGCGGGCCCCGCGGCGCGCTGGG - Intronic
1100330105 12:93573402-93573424 TGCTGGGCCTGCGGGGCCCGCGG - Intronic
1101494010 12:105236311-105236333 CGCGGGGAGCGGGGGGCTCTGGG + Intronic
1103325318 12:120116536-120116558 GGCGCGGCCCGCGGGGGCCTCGG - Intronic
1103764086 12:123269664-123269686 TGGGGCGCCTGGGGGGCTCTGGG + Intronic
1104448978 12:128853992-128854014 AGCGGGGTCCGCGGAGCTCCCGG + Intronic
1105240945 13:18609422-18609444 CGCGGGGCGCGCGGGGCGCCAGG - Intergenic
1106517042 13:30465005-30465027 TGCGGGGGCGGCGGGGCGCGCGG - Intronic
1108643635 13:52406168-52406190 GGCGGGCCCCGCGGGGCTGTGGG - Intronic
1115320778 14:32077211-32077233 TGCGGGAGCCGTGGGGCTCAGGG + Intronic
1115398988 14:32938207-32938229 TGCACCGCCCACGGGGCTCTTGG + Intronic
1119808671 14:77498893-77498915 TGAGGGGCGCGCGGGGCACGGGG + Intergenic
1122028469 14:98895071-98895093 TGCATGGCCCAGGGGGCTCTGGG + Intergenic
1122113593 14:99517166-99517188 TGCGGGGCAGGCCGGGCCCTGGG + Exonic
1122582197 14:102777759-102777781 GGCGGGGCCCGGGGGCCTCGGGG + Intronic
1122776033 14:104117293-104117315 TGCGCGACCAGCGGGGATCTGGG + Intergenic
1122883167 14:104699190-104699212 GGAGGGACCCCCGGGGCTCTTGG + Intronic
1123735579 15:23180000-23180022 CGCGGGGCCGGCGCTGCTCTGGG + Intergenic
1123931814 15:25175572-25175594 TGGGGGGCCACAGGGGCTCTGGG + Intergenic
1124286295 15:28402983-28403005 CGCGGGGCCGGCGCTGCTCTGGG + Intergenic
1127142657 15:55993487-55993509 TGCGGGGACCGCGGGGCTGCGGG - Intronic
1128547790 15:68579339-68579361 TGCGGGGGGCGCGGGGGTGTGGG + Intronic
1129150446 15:73684682-73684704 TGTGGGGCCCGCGGAGAGCTGGG + Intronic
1131260259 15:90884254-90884276 TGCGGGGCGCGGGCGGCTCTTGG + Intronic
1132544544 16:527343-527365 TCCGTGTCCCGCGGGGCTCTGGG - Intergenic
1132646970 16:1003635-1003657 TGCAGGGCATGAGGGGCTCTGGG - Intergenic
1132699195 16:1215110-1215132 TGGGGGCCCCTCAGGGCTCTGGG + Intronic
1132731978 16:1367170-1367192 TGCCGGGGCTGCGGGGCTGTGGG - Intronic
1132852106 16:2029432-2029454 GGCGGGGCCGGCAGGCCTCTTGG + Intronic
1133333638 16:4991969-4991991 TACGGGGCCCGTGGGCCTCCAGG - Exonic
1133350428 16:5097603-5097625 GGAGAGGCCCGCGGGGCTCGCGG - Intronic
1135565833 16:23510343-23510365 TGCCGGGCCCGGGGGACCCTGGG + Exonic
1136319083 16:29470851-29470873 TGAGGGGCCTGAGGGGCTCAAGG + Intergenic
1136378585 16:29879927-29879949 TGGGGGGCCCAGGGGGCTCCAGG + Exonic
1136433654 16:30210195-30210217 TGAGGGGCCTGAGGGGCTCAAGG + Intergenic
1137568452 16:49549185-49549207 TCCTGGGGCCGTGGGGCTCTTGG + Intronic
1138089912 16:54165537-54165559 TGCTGGCCCCGCGGGGCTGAAGG + Intergenic
1138450657 16:57092169-57092191 TGCGGGGCCCCAGGGCCGCTTGG - Intergenic
1141572464 16:84942173-84942195 TGCGGTGCCAGAGGGCCTCTCGG - Intergenic
1142149813 16:88507702-88507724 TGAGGGGCCCGCATGGCTGTGGG + Intronic
1142193052 16:88726662-88726684 AGCGGGGCCAGCGGGGCCCCAGG + Intronic
1142403566 16:89873712-89873734 CGCCGGGCCCGAGGGGCTCCTGG - Exonic
1142596272 17:1031528-1031550 TGCGGGGCTCGGGGGGCTGCGGG - Intronic
1142596963 17:1034590-1034612 CGTGGGGCCCTCGGGGCTGTAGG + Intronic
1142638268 17:1270935-1270957 CGCAGGGCCCGCGGGGCGCGGGG - Exonic
1143188289 17:5023685-5023707 TGCAGGGACTGCAGGGCTCTGGG + Exonic
1143490245 17:7281824-7281846 TGCGGAGGCCGCGGGGGTCCCGG - Exonic
1144946193 17:18970741-18970763 TGCTGGGCCAGCGGGACACTGGG + Exonic
1146787820 17:35733925-35733947 TGCCAGGCCCTCTGGGCTCTAGG + Intronic
1147123802 17:38352210-38352232 GGCCCGGCCCGCGGGGCTCCCGG + Intronic
1148122713 17:45222147-45222169 GGCGGGGCCCGCGGGCTGCTCGG - Exonic
1148271737 17:46266946-46266968 GGCAGGGCCGGCGGGGCCCTCGG - Intergenic
1150267827 17:63842471-63842493 CGCGGGGCCCGCGGGGCCCATGG + Exonic
1151156126 17:72123905-72123927 TGCGGGGCCGGCGGGGCCTGTGG - Exonic
1151555047 17:74842580-74842602 TCCGGGGCCTGGGGGCCTCTGGG - Exonic
1152444598 17:80334246-80334268 TGCTGGGTCCGGGAGGCTCTTGG + Exonic
1152703837 17:81833027-81833049 GGCGCGGCCCGCGGGGCGCCTGG - Intronic
1152755402 17:82085039-82085061 GGCGGTTCCCGCCGGGCTCTCGG + Exonic
1152756058 17:82087559-82087581 AGAGGGGCCCGGTGGGCTCTGGG - Intronic
1152823768 17:82450699-82450721 CGCGGGGACCGCTGTGCTCTCGG - Exonic
1153051986 18:908413-908435 TGCGGGGCGCGCGGGGCGGGCGG + Intronic
1154358804 18:13642337-13642359 AGCAGGGTCCGCGGGGCTGTCGG - Intronic
1158564529 18:58543450-58543472 TGGGGGCCATGCGGGGCTCTGGG + Intronic
1158893668 18:61894539-61894561 TCCCGGGCCCGCCGGGCTGTGGG - Intergenic
1159289302 18:66395887-66395909 TGCGGGACCCGCCGGGCCCACGG - Intergenic
1160838760 19:1137010-1137032 TGCTGGGCTCCTGGGGCTCTCGG - Intronic
1161220528 19:3116084-3116106 TGCTGGGCCTCCGGGGCTCCAGG + Intronic
1161273223 19:3401640-3401662 CGGGAGGCCCGTGGGGCTCTGGG + Intronic
1161628431 19:5339791-5339813 TGCGGAACCCGCGGGGCTGGCGG + Intronic
1162572011 19:11479630-11479652 GGCCGGGCCCCCGGGGCCCTGGG + Intronic
1163397222 19:17070683-17070705 TCCTGGGCCCCTGGGGCTCTAGG - Intronic
1163636001 19:18437491-18437513 TGCGGGACCAGGGGGGCTGTAGG - Intronic
1164911077 19:32012481-32012503 TGGGGAGCTCTCGGGGCTCTGGG - Intergenic
1165994246 19:39833282-39833304 CGCGGGGCCCACGGGGGGCTGGG + Exonic
1166300137 19:41908411-41908433 TGCCAGGCCCGAGGGGCGCTCGG + Intronic
1166677278 19:44747856-44747878 GCCGGGGCCCGCGGGGCACCGGG - Intronic
1166857829 19:45792128-45792150 TGAGAGGCCCGCGGGGTGCTGGG - Intronic
1167019187 19:46861349-46861371 GGCGGGGCCCGGGGGGCTGGGGG - Intergenic
1167311198 19:48738936-48738958 TGAGCGGCGGGCGGGGCTCTGGG - Intronic
925892567 2:8447660-8447682 TGTGGGGACCCCTGGGCTCTGGG - Intergenic
933433566 2:82215399-82215421 TGCTGGGCCCGCTTGGGTCTGGG - Intergenic
933991854 2:87639669-87639691 TGAGGGGCCAGTGGGGGTCTTGG - Intergenic
935137614 2:100321679-100321701 CGCGGGGCGCGCGGGGCTCCGGG + Exonic
936301990 2:111311149-111311171 TGAGGGGCCAGTGGGGGTCTTGG + Intergenic
937872379 2:126795423-126795445 TTCGGGGACTGCTGGGCTCTGGG + Intergenic
938374666 2:130797715-130797737 TGCGAGGCCCGCGGAGCTCGTGG - Intergenic
938381176 2:130837303-130837325 TCCTGGGCGCGCGGGGCACTCGG + Intronic
938397854 2:130963965-130963987 TGCGGCGGCCGCGGGGCTGCCGG - Intronic
944675748 2:202033601-202033623 GGCGGTGTCCGCGGCGCTCTGGG - Intergenic
946326116 2:218985443-218985465 TGCGGGGCGCGGGGGGCTGCCGG - Exonic
946376020 2:219309309-219309331 TGCGGCGCCCGCGGCGGCCTGGG - Exonic
946865557 2:224038956-224038978 TGCGGGGCCAGCGGGACCCTGGG - Intronic
947398924 2:229713923-229713945 GGCGGGGCCAGCCGGGCTCTCGG - Intronic
948479333 2:238240230-238240252 TGCCGCCCCCGCGGGGGTCTAGG - Intronic
948660204 2:239502208-239502230 TGCGGGGCAGGCTGGGCTCATGG + Intergenic
948664411 2:239526120-239526142 TGCGGGGCTCCCGGGGCTGCTGG - Intergenic
948789871 2:240371675-240371697 GGCGGGTGCCCCGGGGCTCTGGG + Intergenic
1173870344 20:46337860-46337882 GGCAGGGCCCACGGGGCTCTGGG - Intergenic
1175267082 20:57709602-57709624 CGCGGGGCGCGGGGGGCTCGGGG + Exonic
1175736653 20:61391881-61391903 TCCGGGGCCTGCAGGGCTCTGGG + Intronic
1175873809 20:62220292-62220314 CGCGGGGCGCGCGGGGCGGTGGG - Intergenic
1176162067 20:63653149-63653171 TGCGGCGCCGGCGGGGCTGGTGG - Intronic
1176204818 20:63882540-63882562 TCTGGGGGCCGAGGGGCTCTGGG + Intronic
1176235342 20:64051137-64051159 TGGGGGGCCCGTGGGGCACCAGG + Intronic
1176448210 21:6840223-6840245 CGCGGGGCGCGCCGGGCTCCAGG - Intergenic
1176826380 21:13705245-13705267 CGCGGGGCGCGCCGGGCTCCAGG - Intergenic
1179504968 21:41834289-41834311 TGCTGGGCGCGGGGGGCCCTTGG - Intronic
1179893997 21:44351282-44351304 TGCGGGACCCCCGGGGCTGAGGG + Intronic
1179989515 21:44939945-44939967 TCCGGCGGCCGCGGGGCTCCCGG + Intergenic
1180064386 21:45405289-45405311 TGCGGGGGTCGCGGGGGTCGCGG + Intronic
1180125933 21:45790325-45790347 TGAGGTGACTGCGGGGCTCTAGG + Intronic
1180187459 21:46146497-46146519 GGCGGGGCCCACAGGGCTCCTGG - Intronic
1180951634 22:19723083-19723105 TGGAGGGCCCCCGGGGCACTGGG + Exonic
1184568866 22:45309859-45309881 TCCGGGGACCGCGGGGCCGTTGG + Intronic
1184697914 22:46150258-46150280 TGCAGCGGCCGCGGGGCGCTAGG + Intergenic
1185394172 22:50578345-50578367 AGGGCGGCCCGCGGGGGTCTGGG - Intronic
1185398324 22:50603728-50603750 TGGTGGGCCCGCGGGGCGCGGGG + Intronic
950053647 3:10009642-10009664 GGCGGGGCCCGTGGGGCGTTTGG + Intronic
950305289 3:11911930-11911952 GGCGGGGCCCGTGGGGCCTTTGG + Intergenic
950765023 3:15267157-15267179 TGCCAGGCCCGTGAGGCTCTAGG + Intronic
950912119 3:16605426-16605448 GGCGTGGTCCGCGGGGCTCAGGG + Intronic
952536062 3:34310259-34310281 TCCAGGGCCCGGGAGGCTCTGGG + Intergenic
953657047 3:44862191-44862213 TGCGGGGCCCGCGGGGCTCTTGG + Intronic
954392567 3:50275278-50275300 TAGGGGGCACGAGGGGCTCTGGG - Intronic
957054715 3:75434975-75434997 GGAGAGGCCCGCGGGGCTCGCGG - Intergenic
962259969 3:133895906-133895928 TGCGGGGCCCGCGGGGCTGCGGG + Intergenic
966696330 3:182793705-182793727 CGCGGGGGCCGCGGGGCTGCAGG - Exonic
966696338 3:182793721-182793743 TCCGGGTCCCGCGGGGCGCGGGG - Exonic
967493623 3:190120336-190120358 TGCGGGGCCCCCGAGGCGCTGGG + Exonic
968230677 3:197003127-197003149 GGCGCGGCCCGCGCGGCTCCAGG + Exonic
968405635 4:337220-337242 TGCGAGGCCCGCAGGGCGCTGGG + Intergenic
968697529 4:2040515-2040537 TGCCGGGGCCGCGGAGCCCTGGG - Intronic
968757858 4:2426128-2426150 TGTGGGGCCTGAGGGGCACTCGG + Intronic
968997525 4:3955283-3955305 GGAGAGGCCCGCGGGGCTCGCGG - Intergenic
969441111 4:7217263-7217285 TGCGGGGTCCTCGGGTCTCATGG - Intronic
971405997 4:26321123-26321145 TTCGGGGGCCGCGGCGCGCTTGG + Intronic
971406044 4:26321304-26321326 GGCAGGGCGCGCGGGGCCCTCGG + Intronic
973292338 4:48483287-48483309 GGCGGGGCCTGCGGGGCGCGGGG + Intergenic
985630062 5:1009402-1009424 CGCAGCGCCCGCGGGGCTCACGG + Intronic
985996033 5:3597331-3597353 TGCGGCGGGCGCGGGGCCCTGGG + Intronic
986858923 5:11904129-11904151 TGCGGGCTCCTCGGGGCTCCGGG + Intergenic
990473791 5:56142388-56142410 TGAGGGCCCAGCGGGGGTCTGGG + Intronic
990955062 5:61332441-61332463 TGCGGGGGCGGCGCGGCGCTGGG + Exonic
994026287 5:95088164-95088186 TTCTGGGCCCACGGGGCTTTGGG + Intronic
994075689 5:95646919-95646941 TGCGGGGCCTGAGGCCCTCTTGG + Exonic
997977099 5:138446872-138446894 TGCAGGAGCCGCGGGGCTCCCGG + Exonic
998797462 5:145835252-145835274 CGCGGGGCCCGCGGCGCGCGGGG - Exonic
998797520 5:145835496-145835518 CGCGGGGCCCCGGGTGCTCTGGG - Intergenic
1002065015 5:176647547-176647569 AGGGCGGCCCGCGGGGCGCTGGG + Exonic
1002541119 5:179907383-179907405 TGCACGGCCCCCGGGGCTCGCGG + Intronic
1003107452 6:3227417-3227439 TGGGGACCCCGAGGGGCTCTCGG + Intronic
1003139376 6:3457446-3457468 TGGGGGGCCCGCGCGGCTGCGGG - Intergenic
1004693324 6:18011483-18011505 TGCGGGGCTCGCTGAGCTCACGG + Intergenic
1005408349 6:25515920-25515942 TGCTGGGCCCGAGGGGACCTGGG + Intronic
1008952104 6:57172491-57172513 CGCGGCGCCCGCGGGGCTCGGGG - Exonic
1015938269 6:138424268-138424290 AGCATAGCCCGCGGGGCTCTGGG - Exonic
1018091333 6:160348659-160348681 CGCGGCGCTCGGGGGGCTCTGGG - Exonic
1020097806 7:5378116-5378138 TGCAGGACCGTCGGGGCTCTGGG - Intronic
1022518337 7:30989525-30989547 TGCGGGCACTGAGGGGCTCTGGG - Intronic
1022714925 7:32891210-32891232 CTCGGCGCCCGCGGGGCTCCCGG - Intronic
1023058726 7:36309966-36309988 TGCAGGGCCCAGGGGGCTCTCGG - Intergenic
1024323277 7:48089713-48089735 GACGGAGCGCGCGGGGCTCTGGG + Intronic
1024940491 7:54758910-54758932 TGGCCGGCCCGCGGGGCTCCAGG - Intronic
1024957050 7:54933303-54933325 TGCGGGGGCCGTGGGGCTCAGGG + Intergenic
1029126262 7:98297016-98297038 GGCAGTGCCCGCGGGGCCCTGGG - Intronic
1032002007 7:128271682-128271704 TGCTGGCCCCGCGGGGCTGGTGG + Intergenic
1033220457 7:139523830-139523852 TGGGGGGCCCGCAGGGCGCGCGG + Intergenic
1034344810 7:150379547-150379569 CGGGGGGCGCGCGGGGCTCGGGG - Intronic
1034781856 7:153888189-153888211 TGCGGAGCCTTCGGTGCTCTCGG + Intronic
1034939343 7:155220327-155220349 TGCCGGGCTGGCTGGGCTCTAGG + Intergenic
1034966674 7:155395654-155395676 TGCTGGGACCTCGGGGGTCTGGG - Exonic
1035153184 7:156892570-156892592 TGCGGTGCGCGCCGCGCTCTGGG - Intronic
1036379729 8:8228719-8228741 GGAGAGGCCCGCGGGGCTCGCGG + Intergenic
1041719760 8:60965304-60965326 TGAGGGGCACACGGGCCTCTGGG + Intergenic
1042059091 8:64798411-64798433 CGCGCGGCCCGCGGGGCCCAGGG + Intronic
1043847208 8:85177249-85177271 TGCGGCGCCCACGGGAGTCTGGG - Intronic
1049109416 8:140634396-140634418 CGCAGGCCCCGCCGGGCTCTGGG - Intronic
1049533887 8:143169176-143169198 TGAGGGGACACCGGGGCTCTGGG + Intergenic
1049618846 8:143588858-143588880 TGCTGGGCCCACGGGTCTCGGGG + Intronic
1049716414 8:144095134-144095156 TGTTGGGCCCGCGGGGCGCGGGG + Exonic
1049796516 8:144499617-144499639 TGCGGGGCAGGCGGGGATGTGGG + Intronic
1053526449 9:38835191-38835213 TGCGGGGCCCGAGCTTCTCTTGG + Intergenic
1055728521 9:79257481-79257503 TCCCGGGGCTGCGGGGCTCTCGG - Intergenic
1056678626 9:88697668-88697690 TGCGAGGCCTGTGGGGATCTTGG + Intergenic
1057447544 9:95127838-95127860 TGCTGGACCCGCCGGGCTCCAGG + Intronic
1060051880 9:120383712-120383734 TCGGGGGCCCGCGGGGCTCTGGG + Intergenic
1060209032 9:121699244-121699266 TGCGGGTCCCGCGCGGGTCCCGG + Intronic
1060892281 9:127196558-127196580 TTCGGGGGCTGCGGGACTCTAGG - Exonic
1060973745 9:127753427-127753449 TGAGGAGCCTGCAGGGCTCTGGG + Intronic
1061032657 9:128095411-128095433 TGGGGGCCCAGAGGGGCTCTGGG - Intronic
1061293589 9:129665829-129665851 GGGGGGGCCGGCGGGGGTCTCGG - Exonic
1061512395 9:131069086-131069108 GGTGGGGCCCGAGGGTCTCTGGG + Intronic
1061543138 9:131289001-131289023 AGCGGGGCTCTGGGGGCTCTGGG - Intergenic
1062646753 9:137551757-137551779 GGCGGGGCTCGCGGGGCTGGCGG - Exonic
1203760950 EBV:12858-12880 AGGCGGGCCCGAGGGGCTCTGGG - Intergenic
1203761879 EBV:15930-15952 AGGCGGGCCCGAGGGGCTCTGGG - Intergenic
1203762808 EBV:19002-19024 AGGCGGGCCCGAGGGGCTCTGGG - Intergenic
1203763737 EBV:22074-22096 AGGCGGGCCCGAGGGGCTCTGGG - Intergenic
1203764666 EBV:25146-25168 AGGCGGGCCCGAGGGGCTCTGGG - Intergenic
1203765595 EBV:28218-28240 AGGCGGGCCCGAGGGGCTCTGGG - Intergenic
1203766524 EBV:31290-31312 AGGCGGGCCCGAGGGGCTCTGGG - Intergenic
1203767453 EBV:34362-34384 AGGCGGGCCCGAGGGGCTCTGGG - Intergenic
1203520981 Un_GL000213v1:44295-44317 CGCGGGGCGCGCCGGGCTCCAGG + Intergenic
1187669849 X:21657272-21657294 CGCGGGCCCCGCGGGACTCCTGG - Exonic
1190108368 X:47574301-47574323 TGGGGGGCCCGCCTGGCGCTGGG + Exonic
1191251924 X:58263905-58263927 TGCTGGGCCCGCGGGGGTCCTGG + Intergenic
1191251981 X:58264129-58264151 CGCCGGGCCCGCGGGGGTCATGG + Intergenic
1191252347 X:58265594-58265616 CGCCGGTCCCGCGGGGGTCTTGG - Intergenic
1191253487 X:58270128-58270150 TGCGGGGCCTGCAGGGGTCGTGG - Intergenic
1196734744 X:118974081-118974103 GGCGGGGCTCCCAGGGCTCTCGG + Intergenic
1198404638 X:136300359-136300381 TGCGCGGCCCGCGGGCCTCCCGG - Intergenic