ID: 953658245

View in Genome Browser
Species Human (GRCh38)
Location 3:44871157-44871179
Sequence AGGGTGCTCAGGTGGAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 313}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953658245 Original CRISPR AGGGTGCTCAGGTGGAAGCC TGG (reversed) Intronic
900439470 1:2646212-2646234 AGGGTGCTCACCTGGGAGCTGGG - Intronic
900506506 1:3032123-3032145 AGGGTGCCCGGGTGGCAGCAGGG - Intergenic
900731467 1:4264095-4264117 AGGAGGCTCCTGTGGAAGCCAGG + Intergenic
901054937 1:6444686-6444708 AGTGTGCCCAGGAGGAAGACGGG + Intronic
901791030 1:11653870-11653892 AGGGAGCTCAGGAGGAAGGCAGG + Intronic
903378314 1:22880132-22880154 GGGGTGCCCAGGAGGAAGCCAGG + Intronic
904392956 1:30197773-30197795 AGGGGGCTGAGGTGGAGGACTGG + Intergenic
905309442 1:37038889-37038911 TGCTTGCTCAGGTGGCAGCCTGG - Intergenic
906319030 1:44805422-44805444 AGGGTGCTGGGGAGGAAGCTGGG + Intronic
906534426 1:46543858-46543880 AGGGTGCTCAAGGGTCAGCCTGG - Intergenic
906652794 1:47524815-47524837 GGGGTGCTCAGGTGGAAAGTAGG + Intergenic
906961309 1:50420966-50420988 AGGGGGCTCAGGTGAGAGCGCGG - Exonic
907235413 1:53041817-53041839 CGGGAGCACAGGTGGAAGCAAGG + Intronic
907324550 1:53628504-53628526 CTGGTACTCAGGTGTAAGCCTGG - Intronic
907616499 1:55932075-55932097 AGTGTGCACAGATGGAAACCAGG + Intergenic
909240189 1:73203238-73203260 AGGAGGCTGAGGTTGAAGCCTGG - Intergenic
911005494 1:93217536-93217558 GGGACGCTCAGGGGGAAGCCTGG - Intronic
911878757 1:103205118-103205140 TGGGTGCTCAGGAGAAAACCAGG - Intergenic
914322993 1:146583218-146583240 ATGGTGGTCAGGAGGAGGCCAGG + Intergenic
914747759 1:150512155-150512177 AAGGTGGACGGGTGGAAGCCTGG - Intronic
915543209 1:156581813-156581835 AGGGTGACCAGGGAGAAGCCTGG + Exonic
915889037 1:159753846-159753868 AGGTTGTGCAGGTAGAAGCCGGG + Intergenic
916483898 1:165240604-165240626 AGGTTGGTCAGGTGGCCGCCTGG + Intronic
916619911 1:166486031-166486053 TGGGTGCTCAGGGGGAAGAGGGG - Intergenic
917847771 1:179036185-179036207 ATGGAGCTCAGGTTGAAACCAGG + Intronic
918423450 1:184386627-184386649 AGGCTGCTCGGGGGGCAGCCGGG - Intergenic
920446480 1:206022318-206022340 AGGGTGCTCACCAGGAAGCCAGG + Intronic
920838700 1:209535742-209535764 ATGGTGCACTGGTGGCAGCCTGG + Intergenic
921251003 1:213298027-213298049 GGGGTGCTCAGCTTGAAGCAGGG - Intergenic
922576690 1:226665629-226665651 CGGGGGCTGAGATGGAAGCCAGG + Intronic
923216407 1:231851966-231851988 AGGGTGCTTAGGAGGAGGTCTGG + Intronic
924090069 1:240492744-240492766 AGGGGGCACAGGTGGGACCCGGG + Exonic
924569009 1:245220907-245220929 AGGATGCTCAAGTTGAAGCCTGG + Intronic
924939207 1:248800510-248800532 AGTGTGCTAAGGTGGAACGCTGG + Intergenic
1063129198 10:3162817-3162839 AGGGTGCCCAGGAGAAACCCGGG + Intronic
1063352443 10:5367971-5367993 AGGGTGCTGAGATGCAACCCTGG - Intronic
1063451635 10:6154097-6154119 AGGGTGAGAGGGTGGAAGCCAGG + Intronic
1064369419 10:14738432-14738454 ACTGTGGTCAGGAGGAAGCCTGG - Intronic
1064481472 10:15744624-15744646 AGGGAGCTTGGGTGGAAGACTGG - Intergenic
1065277956 10:24105365-24105387 AGGAAGAGCAGGTGGAAGCCAGG + Intronic
1069514319 10:69065576-69065598 AAGGTGCCCAGCTGGAAACCCGG - Intergenic
1070458560 10:76642320-76642342 AGGCTGCTCAAGGGGAAGCCAGG + Intergenic
1070649538 10:78224969-78224991 AGGTGGCTCAGATGGAGGCCTGG + Intergenic
1071030725 10:81177557-81177579 AGGGACCTCAAGTGAAAGCCTGG - Intergenic
1072425681 10:95328254-95328276 AGGGTGCTCTGGTGGTTTCCTGG - Intronic
1073087856 10:100906171-100906193 AGGAGGCTAAGGTGGGAGCCTGG + Intergenic
1073107266 10:101039301-101039323 AGGGTGTTCAGGAGGAGGCCTGG + Intronic
1073646048 10:105305222-105305244 AGGGAGCTCAGATGATAGCCAGG - Intergenic
1075086447 10:119417289-119417311 GGGGTGCTGAGGAGGAAGGCAGG - Intronic
1075948209 10:126455593-126455615 AGGTGGCTCAGGTGGCACCCGGG + Intronic
1076063569 10:127431063-127431085 TGTGTGCTCAGGAGGAAGCTGGG + Intronic
1076067525 10:127460604-127460626 AGGAGGCTCAGTTGGCAGCCTGG + Intergenic
1076130027 10:128007728-128007750 AGTGTGCACAGCTGGAAGGCAGG + Intronic
1076567571 10:131409388-131409410 AGGGTGCTGAGGGGGAGGACAGG - Intergenic
1076624325 10:131812212-131812234 AGGGTTCTCACGTGGACGCTAGG - Intergenic
1076735419 10:132456872-132456894 CGTGTGCTCAGGTGAGAGCCAGG + Intergenic
1076790278 10:132773586-132773608 TGGGTGCTCAGGAGGGAGCGAGG + Intronic
1077184796 11:1231234-1231256 AGTGGGCTCAGGTGGAGACCGGG - Intronic
1078103943 11:8346583-8346605 GGGAGCCTCAGGTGGAAGCCGGG - Intergenic
1078549999 11:12273691-12273713 AGAGGGCTCAGGTGGATGCATGG + Intergenic
1080299541 11:30768810-30768832 AGGGAGAACAGGTAGAAGCCCGG + Intergenic
1080687755 11:34529388-34529410 GGGGTTCTCAGGTGGGAGACTGG + Intergenic
1080876184 11:36276465-36276487 TGGGTGTTCAGGTAGAAGCCTGG - Intronic
1081757441 11:45554571-45554593 AGGGTCCCCAGGTGGAAGGCAGG - Intergenic
1081771291 11:45651876-45651898 AGGATGCTCAGGTGGGCTCCTGG - Intronic
1083309296 11:61776284-61776306 AGGGTGCTCAGGGGGCAGGGAGG - Intronic
1083443617 11:62692589-62692611 AGGCTTCTCAGGTAGAATCCTGG + Intronic
1084196224 11:67524630-67524652 AGGATGATCAGGTGGAGCCCCGG - Intergenic
1084939902 11:72606968-72606990 TGGGTGCTGATGAGGAAGCCAGG + Intronic
1085450393 11:76628724-76628746 AGGGTGCTCAGGTTCAACACAGG + Intergenic
1086240440 11:84683733-84683755 AGGGTGTTTAGGTGGAAGGATGG + Intronic
1087836412 11:102879653-102879675 AGGGTTTGCAGGTGGATGCCAGG + Intergenic
1089239495 11:117064089-117064111 AGGCTGCTCAGGATAAAGCCAGG + Intronic
1090037690 11:123263118-123263140 CTGATGCTCAGGTGGAAGCAAGG + Intergenic
1090251296 11:125253761-125253783 AGGATGCTCAGGAGGGACCCTGG + Intronic
1090252943 11:125263933-125263955 AGGGTGCGGAGAAGGAAGCCAGG - Intronic
1091603974 12:1935014-1935036 AGGGTGCCCTGCTGGCAGCCAGG + Intergenic
1091963590 12:4719904-4719926 ACGCTGCTCAGGGAGAAGCCAGG + Intronic
1095272314 12:40234114-40234136 AGGGTGATTAGGAGGAAGGCTGG + Intronic
1096510627 12:52125965-52125987 ACAGTGCTCAGGTGCCAGCCAGG + Intergenic
1096896153 12:54822043-54822065 AGAGGGCTGAGGTGGGAGCCTGG + Intergenic
1097626095 12:62002362-62002384 AGGGTGCTCAGCGGGGAGCCAGG - Intronic
1101059302 12:100954452-100954474 TGGGTGCTCAGATGGAAGGTGGG - Intronic
1102458139 12:113083792-113083814 AGGGTGGACAGAAGGAAGCCAGG - Intronic
1102488811 12:113276588-113276610 AGGCTGCGCAGGGGCAAGCCAGG - Intronic
1102735892 12:115159080-115159102 ATGGTGCTGATGTGGAAACCTGG + Intergenic
1105403878 13:20118443-20118465 CGGGTGCTCAGGACGCAGCCCGG - Intergenic
1105506023 13:21010378-21010400 AGGGTGACCAGGTGGAGGACTGG - Intronic
1107644899 13:42483824-42483846 GAGGTGGTCAGGTGGTAGCCTGG - Intergenic
1108429465 13:50339779-50339801 AGGGTGCTGAGTTGGCAACCTGG + Intronic
1109431742 13:62245624-62245646 ATTGTGCTGAGGTGGAACCCTGG - Intergenic
1110375950 13:74794177-74794199 AGGTTTCTCAGGTGGTAGGCAGG + Intergenic
1110619477 13:77578863-77578885 AGTGTGCTCAGGTAAAAGGCAGG + Intronic
1112010797 13:95292252-95292274 AGGGGGCTGAGGTGGAAGGATGG + Intronic
1118777279 14:68980561-68980583 TGGGTGCTGGGGTGGAAGACTGG - Intergenic
1120617139 14:86721110-86721132 ATGGTGCTCTGGAGGATGCCAGG - Intergenic
1120879716 14:89405596-89405618 AGGGGGCTCAGGATGGAGCCTGG + Intronic
1121017184 14:90555957-90555979 AGGGAGCTCATGTGGACCCCGGG - Intronic
1121343869 14:93120908-93120930 CCGCTGCTCAGGTGGAAGCAGGG + Intergenic
1121729779 14:96178356-96178378 AAGTTGCTCAGGTTGAAGCCAGG - Intergenic
1122870093 14:104634531-104634553 GGGGTGGGCAGGTGGTAGCCGGG - Intergenic
1122934955 14:104951644-104951666 AGGGCCCCCAGGTGGAAGTCAGG - Exonic
1123061559 14:105596986-105597008 TGGGGGCTCAGGTGGATGGCAGG + Intergenic
1123918562 15:25054836-25054858 CTGGTGCTATGGTGGAAGCCTGG + Intergenic
1128226638 15:66006318-66006340 AGGGAACTCAGGGAGAAGCCTGG - Intronic
1128313811 15:66647623-66647645 AGGGTGCTCGGCTGGGAGCCTGG - Intronic
1131810252 15:96166064-96166086 AGGGGGCTCAGGGGGAGGGCAGG - Intergenic
1132581225 16:685587-685609 AGGGTCCTCGGCTGGAAGGCAGG + Exonic
1132635601 16:944501-944523 AAGGTGCTCAGGCAGAAGGCCGG + Intronic
1132881297 16:2162804-2162826 AGGGAGCTCAGCTTCAAGCCGGG + Intronic
1133206015 16:4234097-4234119 AGGGGGCTGAGGTGGAAGGATGG - Intronic
1133257117 16:4523829-4523851 AGGGTGGCCAGATGGCAGCCTGG + Intronic
1133776518 16:8899896-8899918 AGGGAGCTCAGGCAGATGCCTGG - Intronic
1134683862 16:16145362-16145384 TGCATGCTCAGGTGGAATCCGGG + Intergenic
1134798826 16:17065977-17065999 AGAATGCTCTGGTGGAAACCAGG - Intergenic
1135883205 16:26279478-26279500 AGGTTTCTCAGGTGGTAGGCAGG + Intergenic
1136277444 16:29187250-29187272 AGGGTGCTCAGTGTGGAGCCCGG - Intergenic
1136544315 16:30947305-30947327 AGGGTGGTGAGGTGGGAACCTGG - Exonic
1138271725 16:55700342-55700364 AGGGGGCTGAGGGGGAAGACGGG + Intronic
1139321445 16:66117655-66117677 AGGATTCTTGGGTGGAAGCCTGG - Intergenic
1139546807 16:67653393-67653415 GGGGTGGTCAGGAAGAAGCCAGG - Intronic
1140010568 16:71127632-71127654 ATGGTGGTCAGGAGGAGGCCAGG - Intronic
1140351718 16:74268423-74268445 AGGCTGCTCTAGTGGCAGCCTGG - Intergenic
1140476147 16:75240090-75240112 TGGTTGCTAAGGTGGGAGCCTGG - Intronic
1141213743 16:82004842-82004864 AGTGTGCTCAGGTGAAATCAGGG + Intronic
1141544451 16:84755400-84755422 AGGCTGCTCAGCCAGAAGCCGGG - Intronic
1141689723 16:85589235-85589257 CAGGTGCTCAGGTGGCATCCTGG - Intergenic
1141831703 16:86512748-86512770 TGGGTGCGCAGCTGGAAGGCCGG + Intronic
1142171711 16:88625925-88625947 AGGGGGCTGAGGTTGAATCCGGG - Intronic
1142351636 16:89583403-89583425 AACAGGCTCAGGTGGAAGCCAGG - Intronic
1142484510 17:237768-237790 AGGGCTCTCAGGTGGGGGCCAGG - Intronic
1143967552 17:10767638-10767660 AAGGAGCTCAGATGGCAGCCTGG + Intergenic
1143977009 17:10837480-10837502 AGGGTGCTCAGGAGGACGGCTGG + Intronic
1144201972 17:12949719-12949741 GGGGTACTCACTTGGAAGCCTGG - Exonic
1144723833 17:17491367-17491389 TCGGGGCTCAGGTGGATGCCGGG - Exonic
1144783336 17:17818637-17818659 AGGGTCCCCTGGTGGTAGCCAGG - Intronic
1145003020 17:19318768-19318790 GGGGTTCTCACGTGGAAGCCTGG + Intronic
1146060073 17:29600309-29600331 AAGGTGATCAGGTGGCAGGCTGG + Intronic
1146587319 17:34093489-34093511 AGTCTGGTCAGGTGGGAGCCAGG - Intronic
1146818552 17:35965066-35965088 AAGGTCCTCACGTGGAAGTCAGG + Intergenic
1147388252 17:40094261-40094283 AGGGAGCCCAGGTGGAAGGATGG + Intronic
1147832918 17:43309763-43309785 AGTGTGGTCACTTGGAAGCCTGG + Intergenic
1148697714 17:49571019-49571041 AGGGTGCTCAGGTGAACAGCAGG - Intergenic
1148849160 17:50546372-50546394 AGGGTGCTCAGGGGGAGTGCTGG - Intronic
1149850033 17:60028682-60028704 AGGGTGCTCAGGGGCCTGCCGGG + Intergenic
1149860134 17:60117842-60117864 AGGGTGCTCAGGGGCCTGCCGGG - Intergenic
1150348628 17:64424138-64424160 AGGGTGGGTAGGGGGAAGCCAGG - Intergenic
1151078829 17:71304868-71304890 AGGTTTCTCAGGTGGTAGGCAGG - Intergenic
1151987591 17:77554031-77554053 AGGGTGCCCTGGTGGGAGACAGG + Intergenic
1152294526 17:79458995-79459017 AGTGGGCACAGGTGGAGGCCTGG - Intronic
1152410301 17:80119672-80119694 GGGGTGCTCAGGTGGAGGTGTGG + Intergenic
1152533901 17:80939555-80939577 AGGGTGCTGAGCTGCAAGCCTGG - Intronic
1153715004 18:7838974-7838996 AGGGAGCTCTGGTGGTAGTCTGG - Intronic
1153769256 18:8401949-8401971 TAGGGGCTCAGGTGGGAGCCTGG - Intronic
1155253965 18:23978567-23978589 AGTGTGTTCAGGTGGCATCCAGG - Intergenic
1157597291 18:48871478-48871500 AGGGCGCTTAGGTGGGTGCCTGG - Intergenic
1157614433 18:48978299-48978321 AGGGCGCTTAGGTGGGTGCCTGG + Intergenic
1160307642 18:77754912-77754934 AGGCAGCCCAGGTGGAAGTCAGG + Intergenic
1160851176 19:1193380-1193402 TGGGGTTTCAGGTGGAAGCCAGG - Intronic
1161302752 19:3550972-3550994 ACGGCACTCAGGTGGGAGCCTGG - Exonic
1161588600 19:5118560-5118582 AGGGGGCTCAGGCAGAAGCCGGG - Intronic
1161851571 19:6740305-6740327 GGGGTGAGCAGGGGGAAGCCAGG - Intronic
1162746379 19:12801121-12801143 AGGGGGCCCAGGTAGAAGCGGGG - Intronic
1162929976 19:13952811-13952833 AGGGGGCTCAGTTGGGGGCCTGG + Intronic
1163592456 19:18202126-18202148 AGGAGGCTCAGGTGGAAGAATGG + Intronic
1164600811 19:29562144-29562166 ACAGTGGTCAGGTGGAATCCTGG + Intronic
1166072916 19:40397311-40397333 CGGGTGCAGAGGTGGAGGCCCGG - Exonic
1166353089 19:42209886-42209908 AGAGTGCCCAGGTGTATGCCTGG + Intronic
1166634329 19:44436266-44436288 GGGAGGCTGAGGTGGAAGCCTGG + Intronic
1166740104 19:45109424-45109446 AGGGTGCTTTAGTGGAGGCCCGG + Intronic
1166808615 19:45501724-45501746 AGGCTGCTGGGGTGTAAGCCTGG - Intronic
1167081683 19:47280408-47280430 AGGGGGCGATGGTGGAAGCCAGG + Intergenic
1167107376 19:47438106-47438128 ACGGTGGTCAGGTGGGAGGCTGG - Intronic
1167665365 19:50820333-50820355 AGGAGGCTCATGTTGAAGCCAGG + Exonic
1168107684 19:54174363-54174385 AGGAAGCTCAGGTAGTAGCCCGG + Exonic
1168242911 19:55096194-55096216 AGGGTGCTGGGGTACAAGCCCGG + Intronic
1168289518 19:55350712-55350734 AGGGTCCTCTGGTCGAAGCCTGG + Exonic
1168568324 19:57442819-57442841 AGGGGTCAGAGGTGGAAGCCAGG - Intronic
926027344 2:9556247-9556269 AGTGTGCTCAGGTGGGAGGGCGG + Intergenic
927203015 2:20590133-20590155 GGGCTGCTGAGGTGGAAGCTGGG + Intronic
927712033 2:25332084-25332106 AGGGAGCCCGGGTGGAAGGCTGG - Intronic
929559280 2:42945660-42945682 AGGGAGCTGGGGTGGAGGCCAGG + Intergenic
929668910 2:43853954-43853976 CCTGTGCTCAGGTGGCAGCCTGG + Intronic
929997613 2:46838703-46838725 AGATTTCTCAGGTGGAGGCCAGG - Intronic
932316918 2:70790661-70790683 CGGGTGCGCAGGTGAAAGCCCGG - Intergenic
933901868 2:86855925-86855947 TGGGTGCTCAGGAGGAATCCAGG - Intronic
934896077 2:98121424-98121446 TGGATGCTCTGCTGGAAGCCGGG + Exonic
934947120 2:98550141-98550163 AGGGTCCTCAGAGGGAACCCAGG - Intronic
935778677 2:106493339-106493361 TGGGGGCTCAGGAGGAATCCAGG + Intergenic
936701085 2:115012252-115012274 AGGTTCCTCAGGTGGTAGACAGG - Intronic
939555903 2:143673072-143673094 AGTGTGCCCAGGTGGAAAGCTGG - Intronic
942184941 2:173416044-173416066 AGGGGGCTGCGGAGGAAGCCAGG + Intergenic
942250766 2:174046071-174046093 AGGTTGCTGAGGTGGAAGGTGGG + Intergenic
943453840 2:188078298-188078320 TTGGTGCTGAGGTGGAAGTCAGG - Intergenic
944495495 2:200303638-200303660 AGGGTGCTTAATTGTAAGCCTGG - Intergenic
946604494 2:221388412-221388434 AGTGTGATCAAGTGGAACCCTGG + Intergenic
948862583 2:240760134-240760156 GGGGTGGTGAGGAGGAAGCCTGG - Intronic
1171017679 20:21556694-21556716 CCTGTTCTCAGGTGGAAGCCAGG + Intergenic
1171111834 20:22491222-22491244 AGGGAGCTCAGGGGGCAGGCAGG - Intergenic
1172479072 20:35260429-35260451 AGGGAGCTCAGCTGGGAACCAGG - Intronic
1172551198 20:35801566-35801588 TGGGAGCCCAGTTGGAAGCCCGG + Exonic
1174252506 20:49230297-49230319 ATGCTGCTCAGGTGGAAGGAAGG - Exonic
1174277834 20:49416715-49416737 AGGCTGCTCAAGTGGAACCCAGG - Intronic
1176388141 21:6149922-6149944 TGGGTGCTCAAGGGGCAGCCCGG - Intergenic
1178689812 21:34741513-34741535 AGATTGCTCAGCTGGTAGCCTGG - Intergenic
1178958098 21:37041519-37041541 AGGATGCTCAGGGAGAAGCAGGG + Intergenic
1179735331 21:43388326-43388348 TGGGTGCTCAAGGGGCAGCCCGG + Intergenic
1180861990 22:19088811-19088833 AGGGTGCTGAGGCAGAAACCAGG + Intronic
1181466490 22:23113300-23113322 AGAGTGCTGGGGTGGGAGCCGGG - Intronic
1181913905 22:26263750-26263772 TGGTTGCTCAGGCAGAAGCCTGG + Intronic
1183388492 22:37529074-37529096 GGGGTGCTGAGGTGGAAGGATGG + Intergenic
1184091926 22:42297478-42297500 AGGGTGCTCAGGAGGCAGTGGGG - Intronic
1184334676 22:43846122-43846144 AGGGAGCTCAGGGGAGAGCCAGG - Intronic
1184799807 22:46752561-46752583 AGGGGGCTCAGCTTGGAGCCAGG - Intergenic
1185103106 22:48852198-48852220 AGGATGCCCAGGAGAAAGCCAGG - Intergenic
1185122462 22:48980471-48980493 CAGGTGCTCAGGTGGACCCCTGG - Intergenic
1185400134 22:50611304-50611326 ATGGAGCTCAGGGGGAAGCAGGG + Exonic
952263416 3:31762564-31762586 AGGAGGCTGAGGTGGCAGCCTGG - Intronic
952763159 3:36933548-36933570 AGGGTGCTGGGGTGGATGCTAGG - Intronic
953658245 3:44871157-44871179 AGGGTGCTCAGGTGGAAGCCTGG - Intronic
954452357 3:50578651-50578673 AGGGTCCCCAGCTGGCAGCCTGG - Intronic
955590158 3:60526403-60526425 AGGTTGCTCAGGTAGATGCTGGG - Intronic
958775173 3:98473888-98473910 AAGGGGCTCAGGTGGAAGGGTGG - Intergenic
960720036 3:120616656-120616678 AGGGTGCTCAGGTGGGGCACAGG - Intergenic
961476177 3:127147669-127147691 AGGGTGCTCAGGGAGGAGCGAGG - Intergenic
967110986 3:186293734-186293756 CTGTTGCCCAGGTGGAAGCCAGG - Intronic
967188523 3:186965657-186965679 AGGGAGCTCAGGTGGAGGGGTGG + Intronic
967997630 3:195178777-195178799 AGGGAGCACATGGGGAAGCCGGG + Intronic
968086845 3:195877676-195877698 CGGGGGCTCAGGTGGAAGACAGG + Intronic
968687915 4:1973872-1973894 CGGCTCCTCAGGTGGAGGCCGGG + Intronic
968730674 4:2267914-2267936 AAGGGGCTCAGGAGGAAGCCTGG - Intergenic
968875055 4:3262294-3262316 GGGGTGCTCAGGAGGCATCCTGG + Intronic
972047342 4:34683174-34683196 AGGGGGCTGAGGTGGAAGGATGG - Intergenic
972558046 4:40200069-40200091 GGGGTGCACAGGTGGAGGCTGGG + Intronic
976445182 4:85122533-85122555 AGAGTGCTCAGTTGGATGGCAGG + Intergenic
977648282 4:99439260-99439282 AGTGTGGTCAGGGGCAAGCCTGG + Intergenic
977809312 4:101341248-101341270 GGGATGCTGAGGTGGAAGCTTGG - Intronic
979185146 4:117779872-117779894 AGGGAGCTCAATTAGAAGCCAGG + Intergenic
980732124 4:136837070-136837092 AAGGTGCTCATCTGCAAGCCAGG + Intergenic
981737109 4:147964299-147964321 AGGGTGCGCAGGTTGAGGACCGG - Intronic
983712109 4:170731204-170731226 AGGGAGCTCAGGAGGAAGTCAGG - Intergenic
985153016 4:186963898-186963920 AGAGTGCTGAGGAGGAACCCCGG + Intergenic
985153672 4:186967701-186967723 AGAGTGCTGAGGAGGAACCCCGG + Intergenic
985745070 5:1642218-1642240 AGAATGCACATGTGGAAGCCTGG + Intergenic
985753819 5:1701140-1701162 AGCGTGGGCAGGAGGAAGCCTGG + Intergenic
986104200 5:4644220-4644242 TGGGTGCTCAGTGAGAAGCCGGG - Intergenic
986782310 5:11077731-11077753 GGGGTGCTCAGGAATAAGCCAGG + Intronic
988421833 5:31015263-31015285 TGGCTCCTCAGTTGGAAGCCAGG + Intergenic
990448899 5:55917560-55917582 TGGGTGGTCTGGTGGGAGCCTGG + Intronic
997350928 5:133230912-133230934 TGCGTCCTCAGGAGGAAGCCAGG - Intronic
997714320 5:136030503-136030525 AGGGTGTTGAGGTTGCAGCCAGG - Intronic
999692337 5:154158957-154158979 AGGGTGTTCAGGGGGCACCCAGG + Intronic
999791409 5:154943230-154943252 AGGAAGCTGAGGTGGGAGCCCGG - Intronic
1000040026 5:157478613-157478635 AGGCTGCCCAGGAGGAAGACTGG - Exonic
1001675295 5:173507287-173507309 GGGATGGCCAGGTGGAAGCCGGG + Intergenic
1001759926 5:174198880-174198902 AAGGTGCCCAGGTGGCAGTCAGG - Intronic
1002058584 5:176612727-176612749 TGGATGCTCAGGTGGAAGGTGGG + Intergenic
1002454968 5:179340733-179340755 AGGGGGCTCAGCTGAGAGCCTGG + Intronic
1003119822 6:3310219-3310241 AGGGTGCTCCAGTGGGAGACAGG - Intronic
1003119833 6:3310258-3310280 AGGGTGCTCCAGTGGGAGACAGG - Intronic
1003119847 6:3310317-3310339 AGGGTGCTCGAGTGGGAGGCAGG - Intronic
1003119858 6:3310356-3310378 AGGGTGCTCGAGTGGGAGACAGG - Intronic
1003119862 6:3310376-3310398 AGGGTGCTCGAGTGGGAGACAGG - Intronic
1003119870 6:3310416-3310438 AGGGTGCTCGAGTGGGAGACAGG - Intronic
1003252426 6:4441942-4441964 AGGGTCCTCAGGGGGAATCCAGG + Intergenic
1003478749 6:6511797-6511819 ACTGTACTCATGTGGAAGCCAGG - Intergenic
1005990776 6:30900384-30900406 GGGGTGCTCTGGTGGAGGCCTGG + Intergenic
1006245475 6:32730884-32730906 AGTGTCCTCATCTGGAAGCCTGG + Intergenic
1006326679 6:33359341-33359363 AGGGAAGTCAGGTGGAAGCAGGG + Intergenic
1007337199 6:41162365-41162387 ATGGTGGTCAGGGGGAAGGCGGG - Intronic
1007507335 6:42346173-42346195 AGGGTGCTGAGGTTGGAGACAGG + Intronic
1007722639 6:43894385-43894407 AGGGTGCTCAGATGCATGCCTGG + Intergenic
1008618030 6:53245161-53245183 ATGGTTCTCAGGTGGCAGGCTGG - Intergenic
1008904251 6:56658802-56658824 AGGGAGCTCAGGAGTAAACCAGG + Intronic
1009293597 6:61915074-61915096 AGGGTGTGTAGATGGAAGCCAGG + Intronic
1011345819 6:86368840-86368862 TGGGTGCCCAGGCAGAAGCCTGG + Intergenic
1012215103 6:96572805-96572827 AGTGGGATCAGCTGGAAGCCAGG - Intronic
1014119826 6:117712197-117712219 AGGAGGCTGAGGTGGGAGCCTGG - Intergenic
1015570389 6:134615124-134615146 AGGGTGTTCAGGAGGAGGGCTGG + Intergenic
1015905259 6:138110050-138110072 AGGCTGCCTAGGTTGAAGCCTGG - Intergenic
1015944880 6:138489655-138489677 AGGGTGCTGAGGTGGGAGGATGG + Intronic
1017014364 6:150088256-150088278 AGGATGCTAAGGTGGAAGAATGG + Intergenic
1017117038 6:150987450-150987472 AGGGTGCTCAGCACGTAGCCAGG - Intronic
1017707035 6:157132839-157132861 AGGGTGCCCTGGTGAAACCCTGG - Intronic
1018963590 6:168466323-168466345 GGGGTGCTCTGGATGAAGCCAGG + Intronic
1019453507 7:1112384-1112406 AGAGTGAGCAGGTGGAGGCCGGG - Intronic
1019499080 7:1355452-1355474 ATGGAGCTCAGGAGGGAGCCAGG - Intergenic
1019660318 7:2220337-2220359 GGAGTGGTCAGGAGGAAGCCTGG - Intronic
1020075366 7:5254417-5254439 AGGGAGCTCAGGTGCTTGCCAGG + Intergenic
1022323528 7:29309275-29309297 AGGCTGCTCATCTGGAAGACTGG - Intronic
1023106322 7:36766251-36766273 AGGGTGATCAGGCTGTAGCCTGG + Intergenic
1023350560 7:39316463-39316485 AGGGGGCTCAGGGGCAAGCTAGG - Intronic
1024059612 7:45687959-45687981 AGGGTGCCCAGGAGGAAGCGTGG + Intronic
1024966349 7:55025402-55025424 AGGCTTCTCACTTGGAAGCCTGG + Intronic
1025203709 7:56979146-56979168 AGGGAGCTCAGGTGCTTGCCAGG - Intergenic
1025668232 7:63597784-63597806 AGGGAGCTCAGGTGCTTGCCAGG + Intergenic
1026280103 7:68914651-68914673 ACTGTGCTCAGGTCCAAGCCAGG - Intergenic
1035182100 7:157097045-157097067 ACGTCGCTCAGGTGGAAGCAGGG + Intergenic
1035346309 7:158201886-158201908 AGGGTGCTCAGGGTGCAGCTTGG - Intronic
1036663930 8:10726492-10726514 AGGGAGCTCAGAAGGAAGCCCGG + Exonic
1037840773 8:22244097-22244119 AGGAGGCTGAGGTGGAAGCATGG + Intergenic
1038006301 8:23433211-23433233 AGGGTGCACAGGGGGACGGCGGG + Intronic
1038018413 8:23533452-23533474 AACGTGCCCAAGTGGAAGCCAGG - Intronic
1038737314 8:30182817-30182839 AGGAGGCTGAGGTGGAAGCAGGG - Intronic
1046263845 8:111805785-111805807 AGGTTGCTCACCTGGAAGACAGG + Intergenic
1046300386 8:112278599-112278621 AGAGTGCTCAGGGGAAAGGCTGG + Intronic
1048410919 8:134171720-134171742 GAGCTGCTCTGGTGGAAGCCAGG + Intergenic
1049013053 8:139900379-139900401 AGGGTGCAGTGGTGGCAGCCAGG - Intronic
1049057169 8:140246529-140246551 AGGGTTCTCATATGGAAGACAGG - Intronic
1049094903 8:140542759-140542781 AGTGTGCCCAGGAGGGAGCCAGG - Intronic
1049286966 8:141781037-141781059 AGGGCGCCCACGTGGAACCCAGG + Intergenic
1049642573 8:143722139-143722161 AGGGTGCCCAGGGGGGTGCCAGG + Exonic
1049711904 8:144068539-144068561 TGGGGTCTCAGGTGGAGGCCCGG - Intergenic
1050245144 9:3681497-3681519 AGAGAGCTGAGTTGGAAGCCTGG + Intergenic
1050306239 9:4308495-4308517 AGGGTGTTCAGGTGGGAGATGGG - Intronic
1052550195 9:29938210-29938232 AAAGTTCTCAGGTGAAAGCCTGG - Intergenic
1056154644 9:83822234-83822256 AGGAGGCTGAGGTGGGAGCCTGG - Intronic
1056355441 9:85797210-85797232 AGGAGGCTGAGGTGGGAGCCTGG - Intergenic
1059557339 9:115294518-115294540 GGGGTGCTGAGATTGAAGCCTGG - Intronic
1059673808 9:116517082-116517104 AGGTTTCTCAGGTGGTAGGCAGG - Intronic
1059945426 9:119404343-119404365 AGGGGCCTCAGGTGTAAGCAGGG - Intergenic
1061186966 9:129060485-129060507 ACAGTGCTCAGCTGGAATCCCGG - Intronic
1061313053 9:129776732-129776754 AGGGTTCTGAGGTTGGAGCCTGG + Intergenic
1061888490 9:133605457-133605479 AGGGAGCTCCGGTGGAGGCTGGG - Intergenic
1062024164 9:134332753-134332775 AGGGTGGTCTGGAGGCAGCCAGG + Intronic
1062080221 9:134619835-134619857 TGGGTGATCAGATGGAAGCCAGG + Intergenic
1062245437 9:135563570-135563592 AGAGTGCGCAGGAGGCAGCCAGG - Intronic
1203761134 EBV:13372-13394 AGGGGGCTCGGGTGGGAGGCGGG - Intergenic
1203762063 EBV:16444-16466 AGGGGGCTCGGGTGGGAGGCGGG - Intergenic
1203762992 EBV:19516-19538 AGGGGGCTCGGGTGGGAGGCGGG - Intergenic
1203763921 EBV:22588-22610 AGGGGGCTCGGGTGGGAGGCGGG - Intergenic
1203764850 EBV:25660-25682 AGGGGGCTCGGGTGGGAGGCGGG - Intergenic
1203765779 EBV:28732-28754 AGGGGGCTCGGGTGGGAGGCGGG - Intergenic
1203766708 EBV:31804-31826 AGGGGGCTCGGGTGGGAGGCGGG - Intergenic
1203767637 EBV:34876-34898 AGGGGGCTCGGGTGGGAGGCGGG - Intergenic
1186308407 X:8290069-8290091 AGGTTTCTCAGGTGGTAGCCAGG - Intergenic
1186440622 X:9583127-9583149 AGGGTGGTCAGGCGGCAGCAGGG + Intronic
1189247831 X:39577055-39577077 AGGGTGCTCCGGGAGAAGCTAGG + Intergenic
1189407082 X:40735252-40735274 AGGGTGCTCAGCCGGTAGCCCGG + Exonic
1191257138 X:58284445-58284467 AGGGTGCCTAGCTGGAGGCCAGG - Intergenic
1191717565 X:64204188-64204210 AGGGGGCTCTGCTGGAATCCCGG + Intronic
1192221046 X:69197580-69197602 TGGGTGCTCGGGTGGAAGGCGGG - Intergenic
1196282717 X:113841639-113841661 ATGGTGCTGAGATAGAAGCCAGG + Intergenic
1199872723 X:151913182-151913204 AGGGTCCTGAGGTTGATGCCTGG - Intronic
1199872879 X:151913797-151913819 AGGGTGCTGAGGTCCATGCCTGG - Intronic