ID: 953661221

View in Genome Browser
Species Human (GRCh38)
Location 3:44893359-44893381
Sequence AAATTGCTCCAGATTTTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953661220_953661221 -3 Left 953661220 3:44893339-44893361 CCTTTTCTTAACTCATGCTTAAA 0: 1
1: 0
2: 1
3: 24
4: 349
Right 953661221 3:44893359-44893381 AAATTGCTCCAGATTTTCCCAGG 0: 1
1: 0
2: 3
3: 18
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953661221 Original CRISPR AAATTGCTCCAGATTTTCCC AGG Intronic
900843253 1:5073993-5074015 AAATTGAAGCACATTTTCCCTGG + Intergenic
903401982 1:23060406-23060428 AAAATACTCCAGACTTCCCCTGG - Intronic
905199297 1:36305772-36305794 AAACACCTCCAGGTTTTCCCTGG - Intergenic
906132682 1:43470153-43470175 AAACTGCTTCGGATTTTCCTGGG + Intergenic
906787998 1:48632864-48632886 AAACTGCTTCTGATTTTCTCAGG - Intronic
907654313 1:56326841-56326863 TACTTGCTCCATATTTTCTCTGG - Intergenic
908565458 1:65351182-65351204 CAATTGCTCCAGCTTTTGCCTGG - Intronic
909225405 1:73014521-73014543 AATTTGATTCAGATTTTCCCTGG - Intergenic
909959023 1:81814596-81814618 AAATTGCTCTTGTTATTCCCAGG + Intronic
910273315 1:85420438-85420460 AAAGTGCTCCAGATGTGCCCTGG - Intronic
913011552 1:114688484-114688506 AAATTGAACCATATCTTCCCTGG + Intronic
915882854 1:159691042-159691064 AAATTGCTTCAAATTTTTACAGG + Intergenic
917203125 1:172538516-172538538 AAATTCCTCCAGATTTCCTGGGG - Intronic
917440544 1:175064964-175064986 AAATTGCCCCAGATTTGGCCAGG - Intergenic
918099286 1:181359672-181359694 AAATTCCTCCCGAGCTTCCCTGG + Intergenic
918197024 1:182232257-182232279 ATATTGCTCCTAATTTTCACTGG + Intergenic
918388526 1:184036071-184036093 AAATTGCTCCAGAGTGACCTGGG + Intronic
919684000 1:200464700-200464722 AAATAGCTACAGATTTAGCCAGG + Intergenic
921804824 1:219442316-219442338 AAGTGGATCCAGATTTTCACAGG + Intergenic
922231836 1:223693916-223693938 AAATTGCCCCAGATTTTGCCAGG - Intergenic
923681254 1:236120541-236120563 AAACTGATCCACATTTTCCAAGG + Intergenic
1063587632 10:7366910-7366932 AAATGCCTCCAGATATTGCCAGG + Intronic
1064233458 10:13550767-13550789 TTCTTGCTCCAGATCTTCCCGGG + Intergenic
1066125458 10:32337431-32337453 AAAGAGCTCCAGATATTCACAGG - Intronic
1068057722 10:52032047-52032069 AAATTGCTCAACATTCTCCATGG - Intronic
1068570333 10:58621098-58621120 AAATTTCATTAGATTTTCCCTGG - Intronic
1070023407 10:72608602-72608624 CAATTTCTCCACATTTTCTCTGG - Intronic
1071272145 10:84017877-84017899 AAATTGTTCCATAGTTTCCTAGG - Intergenic
1073619477 10:105031831-105031853 AAGTTTCTACAGTTTTTCCCTGG + Intronic
1075425210 10:122336788-122336810 AAACTGAGCCAGATTTTCCAGGG - Intronic
1075603131 10:123785451-123785473 AACTTGTCCCAGATTTTCCCAGG + Intronic
1076313563 10:129525041-129525063 AAATTGCTCCAAAAATTCCCTGG - Intronic
1078717120 11:13850897-13850919 AAAAAGCTCAAGATTTTTCCCGG - Intergenic
1081174358 11:39908864-39908886 AAATATCTCCACATTCTCCCTGG + Intergenic
1086105404 11:83141554-83141576 AAATTGCCCTAAATTCTCCCAGG - Intergenic
1092654252 12:10668135-10668157 AAATTGCTGGAGATTCTTCCAGG - Intronic
1093687233 12:22070695-22070717 CCATTGCTCCCCATTTTCCCTGG - Intronic
1095031030 12:37279274-37279296 AAATTGCTCCAAATATCCACTGG - Intergenic
1095037931 12:37413182-37413204 AAATTGCTCCAAATATTCACTGG - Intergenic
1095038068 12:37415554-37415576 AAATCGCTCCAAATATTCACTGG - Intergenic
1095066605 12:37785302-37785324 AAAGTGCTCCAAATATCCCCAGG - Intergenic
1097280910 12:57845275-57845297 AAATAGCGGCAGATTTTCCGCGG - Intronic
1097376559 12:58850074-58850096 TATTTGCTCTAGATTTTCACGGG + Intergenic
1099986116 12:89666798-89666820 AAATTACTCCAGCTCTTTCCAGG + Intronic
1100113542 12:91274590-91274612 AAATTGCTTCACATGTTCCAGGG + Intergenic
1100179619 12:92071352-92071374 AAATTGCTACTGGTTTCCCCAGG - Intronic
1104484254 12:129136093-129136115 AAATTGCTCCTGACATTTCCTGG - Intronic
1105510070 13:21043935-21043957 ATCTTACTCCAGATTTCCCCAGG + Intronic
1106117624 13:26830841-26830863 AAAGTGTTCCAGAGTTCCCCAGG - Intergenic
1106339960 13:28818919-28818941 AATTTGCCCCAGATTCTTCCAGG + Intergenic
1107574280 13:41700221-41700243 ATAGTGTTCCAGATTTTCCAGGG - Intronic
1110052533 13:70922673-70922695 AAATTGCTTCACACTCTCCCAGG - Intergenic
1110491706 13:76117696-76117718 AAAATTCTGCAGCTTTTCCCGGG - Intergenic
1111055420 13:82943002-82943024 AAATATTTTCAGATTTTCCCAGG - Intergenic
1112073191 13:95877292-95877314 AAATATCTTCAGATTTTCCTTGG + Exonic
1114908276 14:27158645-27158667 AAATTTCTCCAGTGTTTCCAAGG + Intergenic
1115071236 14:29324240-29324262 AAATTGTTCCATCTTTTCACTGG - Intergenic
1115134407 14:30091395-30091417 AAATTGTTCAAGATTTGCCCTGG - Intronic
1116711688 14:48375994-48376016 AAATTGCTCCAGATACTCACGGG + Intergenic
1117613632 14:57509603-57509625 AAATAGCTACTGATATTCCCAGG - Intergenic
1118788949 14:69071152-69071174 AAATTGGACCTGATCTTCCCTGG + Intronic
1121323961 14:93009041-93009063 AAATGTCTCCAGATGTTCCCTGG - Intronic
1121441753 14:93954023-93954045 AACTTGTTCCAGAATGTCCCAGG - Intronic
1121636257 14:95455701-95455723 ACATTGCCAAAGATTTTCCCAGG - Exonic
1121793329 14:96715489-96715511 GAATTGCTCCTAATTTTCCCTGG + Intergenic
1125761323 15:42097508-42097530 TAATTTCCCCAGATTTTCTCTGG + Intergenic
1126923030 15:53548948-53548970 AAATTTCTCCAGATTCTTTCTGG - Intronic
1130812012 15:87389636-87389658 AAATTGCTCCGTATTTTCTTAGG - Intergenic
1132170640 15:99650304-99650326 AAAATGCTCCAGAGCTCCCCTGG - Intronic
1133753268 16:8741539-8741561 AAATTGCTCCAGATGATTCCTGG + Intronic
1135226703 16:20666032-20666054 AAATGGTTCCAGCTTTTGCCTGG - Intronic
1135966242 16:27037480-27037502 CACTTGCTGCTGATTTTCCCCGG - Intergenic
1137076845 16:35976950-35976972 AAAGTGCTCCAAATATTCCTTGG + Intergenic
1137247599 16:46718284-46718306 AAATTGCTTAGTATTTTCCCTGG - Intronic
1139454260 16:67059722-67059744 GACTTGCTCCAGATTCTTCCTGG + Intronic
1141038587 16:80652192-80652214 CCATTGCTCCAGAGTTTCCTAGG - Intronic
1141250149 16:82348563-82348585 AAATTGATCCAGATGTTCCCTGG + Intergenic
1147360872 17:39928766-39928788 AAAGTGCTCCGCAGTTTCCCTGG - Intergenic
1149118640 17:53132817-53132839 AAATTACTCCAGTTGTTCCTGGG - Intergenic
1150463741 17:65374112-65374134 GAATTGCTCCAGAAATCCCCTGG - Intergenic
1151951821 17:77358748-77358770 ATATTGCACCAGATTCTGCCAGG + Intronic
1155310720 18:24520392-24520414 AAATTGTCCCAGATTTGGCCAGG + Intergenic
1156488707 18:37483684-37483706 AATGTGCTCCTGATTTCCCCTGG + Intronic
1156632003 18:38981400-38981422 GAATTGCTAGAGATTTTCCTAGG + Intergenic
1157785966 18:50482941-50482963 AGTTTGCACCTGATTTTCCCTGG + Intergenic
1158232636 18:55275417-55275439 AAATTCTTCCAGATTCTCTCTGG - Intronic
1165201803 19:34150774-34150796 GAATTGCTCCGGACTCTCCCAGG - Intergenic
1167045008 19:47044701-47044723 AAATATCTCCAGATATTGCCAGG + Intronic
1168121041 19:54252753-54252775 AAACTGCTCCAGAAATTCCCAGG - Intronic
926489390 2:13505301-13505323 AGATTGCTACAGATGGTCCCTGG - Intergenic
926763953 2:16305947-16305969 AGATAGCTCCAAATTTTTCCTGG - Intergenic
927825375 2:26305596-26305618 GACTTGCTCCAGATAATCCCCGG + Intergenic
928072031 2:28226779-28226801 AAATTGCCCCAGCTTATCCAGGG + Intronic
929522035 2:42662195-42662217 AAAGCACTCCAGATGTTCCCTGG - Intronic
929990073 2:46779695-46779717 AAGTTGCTCAAGATTTGCTCTGG + Intergenic
930898566 2:56475354-56475376 AAATAGCTCCAAATTCTCTCTGG + Intergenic
931896912 2:66742632-66742654 AATTTCCTTCAGATTTTCCAAGG + Intergenic
931976316 2:67647492-67647514 AAATTGCTTCTGATTCTACCAGG + Intergenic
932546986 2:72722908-72722930 AAATAGCTCCACATTTTTCAAGG + Intronic
933014833 2:77112112-77112134 AAATAGCCCCAGATTTCCCAGGG - Intronic
933290689 2:80435133-80435155 AAAATGATCCAGATATTTCCTGG + Intronic
935187059 2:100744044-100744066 TAAATGCTGCAAATTTTCCCAGG + Intergenic
936413133 2:112278140-112278162 AAATTTCTTAAGAATTTCCCAGG - Intronic
936695403 2:114941427-114941449 TAAATGATCCAGATGTTCCCAGG + Intronic
937084817 2:119164396-119164418 TAATTGCTCCAGATTATGCTGGG + Intergenic
937219882 2:120336658-120336680 AAATGGCTCCAGTGTTTGCCCGG + Intergenic
940098219 2:150002915-150002937 AAACTGCCCCAAATTTTCCGCGG + Intergenic
943268088 2:185763241-185763263 AAATTTTTCCAGAGTTTCACAGG + Exonic
944189968 2:196992392-196992414 AAATTGCCCCAAACGTTCCCAGG + Intronic
948262507 2:236614674-236614696 AAATTGCCCCAGACTTTCTCTGG + Intergenic
948917437 2:241042011-241042033 CAATTGCCCCAGATTCTGCCTGG + Intronic
1169144855 20:3245701-3245723 AAATTATTCCTGTTTTTCCCAGG - Intergenic
1172254150 20:33502267-33502289 ACATTGTTCCAGATTTGGCCAGG + Intronic
1173066443 20:39717748-39717770 GAATTTGTCCAGATTTTACCAGG + Intergenic
1175090278 20:56497329-56497351 AAACTGCTCCAGGATTTCTCGGG - Exonic
1175342315 20:58241177-58241199 AAATTGTCCTAGATTTTCACAGG + Intergenic
1175678030 20:60963897-60963919 AAATTCCTTCATCTTTTCCCTGG + Intergenic
1177000247 21:15603673-15603695 CATTTTCTCCATATTTTCCCAGG + Intergenic
1177906579 21:26978838-26978860 AAGTTGATCCACTTTTTCCCTGG - Intergenic
1178182637 21:30180813-30180835 AAATATTTTCAGATTTTCCCTGG - Intergenic
1180399549 22:12397847-12397869 AAAATGCTCCAAATATACCCTGG - Intergenic
1182221655 22:28763528-28763550 AAAATACTACAGATGTTCCCTGG - Intergenic
1182270634 22:29151044-29151066 AAATCGATCCACACTTTCCCTGG - Intronic
949898550 3:8791101-8791123 TACTTTCTCCACATTTTCCCAGG + Intronic
952229317 3:31413123-31413145 ACATTGCTCCTGTATTTCCCAGG + Intergenic
952237480 3:31494982-31495004 AACTTACTCCAGATCTTCCAGGG + Intergenic
952992928 3:38847705-38847727 AATGTGCTCCTGATTTTCCAAGG + Exonic
953554534 3:43933137-43933159 AAATTGTTCCAGATGTTCAGTGG - Intergenic
953661221 3:44893359-44893381 AAATTGCTCCAGATTTTCCCAGG + Intronic
953737963 3:45512717-45512739 AAATGTCTCCAGACTTTTCCAGG + Intronic
956515527 3:70042413-70042435 AAATTGCACCAGACTTTTGCTGG + Intergenic
958849614 3:99308228-99308250 AAATTGATTCAGTTTTTTCCTGG - Intergenic
959132158 3:102369501-102369523 AAATTTCTCTAGATTTAGCCTGG + Intronic
962090333 3:132237843-132237865 AACTTGATCCAGATTTTCCCAGG + Intronic
963277255 3:143345010-143345032 AAAAAGCTCAAGATTTTTCCTGG - Intronic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
968228189 3:196989066-196989088 AAATGGCCCCAGCATTTCCCAGG - Intronic
969449615 4:7265572-7265594 TGATGGCTCCAGATGTTCCCAGG + Intronic
971337081 4:25733159-25733181 AAATTTTGCCAGATTTTCACTGG + Intergenic
973280223 4:48352608-48352630 AAATGTCTCCAGATGTTGCCAGG + Intronic
974903255 4:68027038-68027060 AATTTTCTCCTGATTTTCTCTGG - Intergenic
975242492 4:72077628-72077650 AAATTGCTGCAGATCTTGACAGG + Intronic
975281019 4:72562963-72562985 AAATTACTCATGATTTTGCCAGG + Intronic
975367854 4:73549381-73549403 AAATTTCTCTATATTTTCCAAGG - Intergenic
977393950 4:96448987-96449009 AAATCCCTCAAGATTTGCCCAGG + Intergenic
982799309 4:159684081-159684103 AAAATGCTCCTGATTTTAACTGG + Intergenic
982854043 4:160358731-160358753 AAAATGCTCAAGATATTACCTGG - Intergenic
984998351 4:185459756-185459778 AAACTGATCCAGATGTTCACAGG - Exonic
986728999 5:10621186-10621208 AAAGTGTTCCACATTCTCCCTGG + Intronic
988545243 5:32150367-32150389 AAATAGCAACAGATTTTCCCTGG + Intronic
988894477 5:35657215-35657237 AAGTTGTTCCAGTTTCTCCCTGG + Intronic
989686385 5:44092314-44092336 TAATTGCTCTAGTTTTTCCAGGG - Intergenic
989894436 5:47047072-47047094 AAATCGCTCCAAATATCCCCTGG - Intergenic
989895504 5:47067611-47067633 AAATCGCTCCAAATATCCCCTGG + Intergenic
989899637 5:47150884-47150906 AAATCGCTCCAAATATCCCCTGG - Intergenic
989967490 5:50482132-50482154 AAACTTCTCCAGATTCTCTCAGG - Intergenic
994141909 5:96350892-96350914 AAATGGCTCTTGATTTCCCCTGG + Intergenic
994731620 5:103498563-103498585 AAGCTTCTACAGATTTTCCCAGG - Intergenic
994782043 5:104102332-104102354 AAATGTCTCCAGATTTTACTAGG + Intergenic
996094482 5:119383841-119383863 AAACTGCTCAAGTTCTTCCCTGG + Intronic
998384322 5:141747730-141747752 AAAATGGACCAGACTTTCCCTGG - Intergenic
1002411279 5:179079045-179079067 AAATGCTTCCAGATTTACCCAGG + Exonic
1002695130 5:181082730-181082752 AAACTTCCCCAGATTTTCCCCGG - Intergenic
1003474104 6:6465564-6465586 AAAGTGCTCCAGAGTGACCCTGG - Intergenic
1003768591 6:9270337-9270359 CAAAAGCTCCAGTTTTTCCCAGG - Intergenic
1004655688 6:17657706-17657728 AACATGCTACAGATTTTACCAGG + Intronic
1007736800 6:43987062-43987084 ACCTTGCTCCATGTTTTCCCTGG + Intergenic
1008002236 6:46372752-46372774 AACCTGCCCCAGAATTTCCCTGG + Intronic
1008375822 6:50790235-50790257 AAAATGATCCAGATCTGCCCAGG - Intergenic
1008814652 6:55550782-55550804 AAATTTCTCCAGACATTGCCGGG - Intronic
1009159792 6:60267938-60267960 AAGTTGCACCAGATTTCCTCAGG - Intergenic
1009975246 6:70665003-70665025 AAACTTTCCCAGATTTTCCCAGG + Intergenic
1010407282 6:75519666-75519688 CAATTCCCACAGATTTTCCCTGG + Intergenic
1013557010 6:111266612-111266634 AAAATGCTGCAGATTTCCCATGG - Exonic
1014896216 6:126903172-126903194 AAATTACTCCAAATTCTCCAGGG + Intergenic
1016560722 6:145392753-145392775 CAATTGCTCCAGATGTTAGCGGG + Intergenic
1018397996 6:163395176-163395198 AAATTGTTCCAGATTCCTCCTGG - Intergenic
1022196114 7:28068988-28069010 AAATTACATGAGATTTTCCCAGG - Intronic
1023270167 7:38453946-38453968 GAATTGCTCAAGTTTGTCCCAGG + Intronic
1024602231 7:50994088-50994110 ACTTTGCTCTAGATTTTCCTGGG - Intergenic
1025770570 7:64501449-64501471 AAATTTTTCCAGGTTTTCCAGGG - Intergenic
1026431999 7:70356974-70356996 AAATTGCTCCCAATGTTTCCTGG + Intronic
1026457340 7:70584244-70584266 AAATGGCTTCAGTCTTTCCCAGG + Intronic
1026969598 7:74459915-74459937 AACTCGCTCCAGATCATCCCCGG - Intronic
1027651769 7:80877127-80877149 TAATTGCTCCAGACTTTACAAGG - Intronic
1033878860 7:145856959-145856981 ATATTGCTACAGTCTTTCCCAGG - Intergenic
1035101793 7:156403707-156403729 AAATTGCTTCCCACTTTCCCAGG + Intergenic
1035481664 7:159191883-159191905 AAATTGTGCCAGAGCTTCCCTGG - Intergenic
1038822128 8:30961917-30961939 AAGTTGCTCCAAAATTTCACTGG - Intergenic
1039186556 8:34923647-34923669 ACACTGCTTCAGATCTTCCCAGG + Intergenic
1040989051 8:53329469-53329491 AAATTGGTCTATATTTTCCCAGG + Intergenic
1043274249 8:78373442-78373464 ATTTTGCTTCAAATTTTCCCAGG - Intergenic
1043289646 8:78581243-78581265 AGATTGTTCGAGATTTGCCCAGG - Intronic
1043610792 8:82060475-82060497 AAATGCCTGCAGCTTTTCCCGGG + Intergenic
1044280102 8:90344394-90344416 ATTATGCCCCAGATTTTCCCTGG - Intergenic
1050990505 9:12145551-12145573 AAATTGTCCCAGATTTGTCCAGG + Intergenic
1051525223 9:18035600-18035622 AAATTGCAACCTATTTTCCCTGG + Intergenic
1051999975 9:23266554-23266576 CAAGAGCTCCAGATTTCCCCAGG + Intergenic
1052437377 9:28445745-28445767 AAATTGCACCTGATTCTGCCTGG + Intronic
1052600476 9:30621902-30621924 AATTTGTACCAAATTTTCCCAGG + Intergenic
1055400894 9:75922812-75922834 AATAAGCACCAGATTTTCCCAGG - Intronic
1056791613 9:89628936-89628958 AAATTGCCAAACATTTTCCCGGG - Intergenic
1057520139 9:95753451-95753473 AAATGTCTCCAGATATTGCCTGG - Intergenic
1203380778 Un_KI270435v1:37221-37243 AAAATGCTCCAAATATACCCTGG - Intergenic
1190707146 X:53038958-53038980 AAATTGTTCCAGAATTTGACAGG - Intergenic
1191094567 X:56660935-56660957 AAATTGTCCCAGAGTTTCACTGG - Intergenic
1191775171 X:64805984-64806006 AAAAGCCTCCAGATTTTTCCTGG - Intergenic
1193405597 X:81097324-81097346 AAATTCCTACAGAATTTCTCAGG + Intergenic
1195247505 X:103007866-103007888 GAAATGCTCCAGCTTTTACCAGG + Intergenic
1197047968 X:122023077-122023099 ATTTTGCTCCAGATTTTTCCTGG + Intergenic
1198800041 X:140439371-140439393 AAAGTGCCCCAGATTTTCAAAGG + Intergenic
1201687955 Y:16728261-16728283 AAATGGCTCCACAATTTTCCTGG - Intergenic
1202093837 Y:21222831-21222853 AAAGTGCTCCAGATGTCACCTGG + Intergenic