ID: 953663161

View in Genome Browser
Species Human (GRCh38)
Location 3:44905755-44905777
Sequence GGCATTGCCCTTATAATAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953663154_953663161 0 Left 953663154 3:44905732-44905754 CCTCCACATTTCTCCAAAGATAA 0: 1
1: 0
2: 0
3: 31
4: 337
Right 953663161 3:44905755-44905777 GGCATTGCCCTTATAATAGGGGG 0: 1
1: 0
2: 1
3: 6
4: 67
953663156_953663161 -3 Left 953663156 3:44905735-44905757 CCACATTTCTCCAAAGATAAGGC 0: 1
1: 0
2: 0
3: 32
4: 268
Right 953663161 3:44905755-44905777 GGCATTGCCCTTATAATAGGGGG 0: 1
1: 0
2: 1
3: 6
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953663161 Original CRISPR GGCATTGCCCTTATAATAGG GGG Intronic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
907225787 1:52945013-52945035 TGCATTGCTCTTATAATCAGTGG - Intronic
909802887 1:79835324-79835346 GGCATTCCCCTTATAAAACAGGG - Intergenic
910159186 1:84255311-84255333 ACCATTGCCCTTATAATAAGAGG + Intergenic
916118606 1:161509081-161509103 GGCAGAGCCCTTATAAAAGAGGG + Intronic
916178929 1:162067418-162067440 GGCACTGACGTTATATTAGGTGG + Intergenic
918408932 1:184238278-184238300 GGCATGGCCCGTATAAAAGCTGG - Intergenic
919493910 1:198240280-198240302 AGCATTTCCCTTAAAATATGAGG - Intronic
921595691 1:217051512-217051534 ATCATTGCCCTTTTAATTGGAGG - Intronic
924418880 1:243888395-243888417 GGAAATGCCCTTATTATAGACGG - Intergenic
1063270221 10:4500310-4500332 GGAATTGACCTTCTAATATGTGG + Intergenic
1065542337 10:26782780-26782802 TGCATTGCCCTAATGATAAGTGG - Intronic
1077372295 11:2188792-2188814 GGCATTGCCCTAATGATTCGTGG - Intergenic
1079680926 11:23297362-23297384 GGCATTGTTCTTATAAGAGATGG + Intergenic
1083038118 11:59659271-59659293 TGCACTGCCCTCATAATAGCTGG + Exonic
1083153758 11:60810147-60810169 GGCTTTGTCCTTATAATAGTGGG + Intergenic
1083617792 11:64035215-64035237 GGCACTGCCCCCTTAATAGGTGG + Intronic
1085730921 11:78997888-78997910 ATCAGTGCCCTTATAAGAGGAGG + Intronic
1132265754 15:100469283-100469305 GGCATTGCCCTTTCCATACGTGG - Intronic
1138297467 16:55899287-55899309 CTCATTGCCATTATAATGGGAGG + Intronic
1140157364 16:72445574-72445596 TGCATTTCCCTTATAATTAGTGG + Intergenic
1140546021 16:75810394-75810416 GGGATAGCCCTTAGAGTAGGAGG - Intergenic
1153784284 18:8520573-8520595 GGCAATGCCCTTAGAAGAGGAGG + Intergenic
1162448258 19:10737811-10737833 GGCATTCCCCTTCTAGTGGGGGG - Intronic
1167739352 19:51314807-51314829 GGGTTTGCCCTTATCAGAGGCGG - Intronic
927297123 2:21467706-21467728 GGCAGTGCCCTTATAAGTGAAGG + Intergenic
927975346 2:27334390-27334412 GGGATTGCTCTTCTGATAGGAGG - Intronic
930001506 2:46864831-46864853 GTTAGTGCCCTTATAAAAGGAGG - Intergenic
932866664 2:75350513-75350535 GTCATTGCCCTTCTAATGGCAGG + Intergenic
938603291 2:132865316-132865338 GCCATTGCCCTCATTATAAGTGG - Intronic
939105892 2:137948065-137948087 GGCATTGCCCATAGAAAAGTAGG - Intergenic
943277824 2:185890807-185890829 GGCATTTCCATTTTAAAAGGGGG + Intergenic
946999792 2:225440853-225440875 TGAATTGCCCTGATAATAGATGG + Intronic
1169952466 20:11060651-11060673 AGGATTGCTCTTATAAAAGGTGG - Intergenic
1174216043 20:48917183-48917205 GGCCTTGCAGTTATAAAAGGGGG - Intergenic
1181384444 22:22533601-22533623 GACAATACCCTTATAAGAGGAGG + Intergenic
953141347 3:40232082-40232104 GACATTGCCCTTATTCTAGTGGG + Intronic
953663161 3:44905755-44905777 GGCATTGCCCTTATAATAGGGGG + Intronic
964588721 3:158336969-158336991 GGCATAGCCGTGATAAGAGGTGG + Intronic
965712533 3:171570079-171570101 GGCATTACTCTGACAATAGGCGG + Intergenic
966387107 3:179410594-179410616 GCTATTGTCCTTATAAAAGGGGG - Intronic
973707721 4:53596782-53596804 GTCATTGTCATTATAATAGGGGG - Intronic
978765701 4:112402986-112403008 GGCATTGCCCATGTAATCAGTGG + Intronic
989262670 5:39435896-39435918 GGCATTCTCCTTATTAGAGGAGG - Intronic
990230369 5:53706392-53706414 GACATTGGCTTTATAAGAGGAGG + Intergenic
990256708 5:53977962-53977984 GGCTTTTCGCCTATAATAGGAGG + Intronic
992902423 5:81311192-81311214 GGCTTTGCTCTTTCAATAGGTGG + Exonic
997601358 5:135140916-135140938 GGCTCTGCCCATATTATAGGAGG - Intronic
999574490 5:152960469-152960491 GTCATTGCCTTTATATTATGTGG - Intergenic
1005852508 6:29832149-29832171 GATATTGCCTTTAGAATAGGGGG + Intergenic
1010176282 6:73031879-73031901 GGAATTGCTCTTATACTGGGAGG - Intronic
1011686171 6:89825539-89825561 ATTATTGCCCTTATAATGGGAGG + Intergenic
1012694339 6:102358238-102358260 GGCATTGACATTATCATAAGGGG + Intergenic
1014916868 6:127161142-127161164 GGCATTGACATTATAATAGCAGG + Intronic
1022787495 7:33653044-33653066 GCCATGACCCTTATGATAGGTGG - Intergenic
1023388705 7:39686398-39686420 GGCATTTCTCTTAAAATAGTTGG - Intronic
1034652046 7:152699349-152699371 GGGATTGCCCTTTAAAAAGGAGG - Intergenic
1045798279 8:106071550-106071572 GGTATTGCCTTTATAATAGGAGG + Intergenic
1046349584 8:112989878-112989900 GGCATTGCCCTTGACATATGAGG - Intronic
1047992089 8:130296973-130296995 GTCTCTGCCCTTCTAATAGGTGG - Intronic
1048289209 8:133167283-133167305 GGCCTTGCCCAGATAATAGTTGG - Intergenic
1051011555 9:12420947-12420969 GGCATTTCTCTTTTAAAAGGTGG + Intergenic
1058811294 9:108642314-108642336 GGCACTGCTTTTATCATAGGTGG - Intergenic
1188274321 X:28181115-28181137 GGTTTTGCACTTATAATGGGAGG - Intergenic
1190233776 X:48601085-48601107 GGCATTCCCCTTTTTATGGGGGG - Intronic
1194674766 X:96781433-96781455 GACATTTCCCTTTTAATAGAGGG + Intronic
1194776929 X:97976641-97976663 GATATTGCCCTTATTATTGGTGG - Intergenic
1197015137 X:121615656-121615678 GGTATTGTCATTATAATAGGTGG + Intergenic
1198402061 X:136278071-136278093 GGAAGTGCCGATATAATAGGGGG + Intergenic
1198597221 X:138249745-138249767 ATTATTGCCCTTATAATAAGAGG + Intergenic
1198891060 X:141396767-141396789 GTCATTTCCTTTATAATATGAGG - Intergenic
1199926182 X:152466917-152466939 TGCATTTCCCTGATAATTGGTGG - Intergenic
1201477844 Y:14403295-14403317 GCCATCGCCCTGATGATAGGAGG - Intergenic
1202329830 Y:23737295-23737317 GGCATTGCCCATGTAAGAGTGGG - Intergenic
1202540940 Y:25932759-25932781 GGCATTGCCCATGTAAGAGTGGG + Intergenic