ID: 953666694

View in Genome Browser
Species Human (GRCh38)
Location 3:44930703-44930725
Sequence ACCTGAGGAGATATGCATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 124}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953666694_953666701 22 Left 953666694 3:44930703-44930725 CCACAATGCATATCTCCTCAGGT 0: 1
1: 0
2: 0
3: 7
4: 124
Right 953666701 3:44930748-44930770 CTCAGAATGATTTCTCTTCTTGG 0: 1
1: 0
2: 0
3: 19
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953666694 Original CRISPR ACCTGAGGAGATATGCATTG TGG (reversed) Intronic
901700928 1:11044493-11044515 ACCCTGGGAGATATTCATTGAGG - Intronic
901734331 1:11302819-11302841 AACTGAGGAGATTCTCATTGAGG + Intergenic
902563968 1:17297722-17297744 ACCTGAGGAAATATTATTTGGGG + Intergenic
908629076 1:66082158-66082180 ACCTGATGAAGTATGCAATGAGG - Intronic
913060232 1:115197744-115197766 AACTGAGGAGACAGGCATTAAGG - Intergenic
916718295 1:167462961-167462983 ATCTGAGGAGACAGGCAATGAGG - Intronic
919138404 1:193539307-193539329 GCGTGAGGTGATATCCATTGGGG + Intergenic
921246035 1:213241705-213241727 ACATGAGGAGAAAGGCATAGAGG + Exonic
923215307 1:231843435-231843457 ATCTGATAAGATTTGCATTGGGG + Intronic
924843989 1:247746818-247746840 ACCTGAGAAGGCATGCATTTTGG - Intergenic
1065224673 10:23531596-23531618 AACTCAGGAGATGTGAATTGTGG + Intergenic
1071383116 10:85090647-85090669 AAATGAGGTGATATTCATTGTGG + Intergenic
1076996251 11:298840-298862 GCCTGAGGAGATACTCCTTGGGG + Intronic
1086203694 11:84233710-84233732 ATCTGTGGTGAAATGCATTGGGG - Intronic
1089003161 11:115068801-115068823 AACTGAGGAGAGATCCAATGAGG - Intergenic
1095318474 12:40796036-40796058 ACATGAGCAGATGTGCATTTTGG - Intronic
1095797749 12:46238802-46238824 AACTGAGGAGAGAAGCAATGGGG - Intronic
1095906642 12:47385135-47385157 ACCTGGGGAGATATCTATTTAGG - Intergenic
1100261926 12:92940604-92940626 ACCTGAGGAAAGAGGCATTAGGG - Intergenic
1101211354 12:102538225-102538247 ACCTGAGGAGGTATAAAGTGAGG + Intergenic
1101443208 12:104718990-104719012 TCCAAAGGAGAAATGCATTGGGG - Intronic
1104170442 12:126275404-126275426 ACCACAGGAGATATACTTTGGGG + Intergenic
1104307828 12:127625452-127625474 ATCTGAGGAAAGATGCATTATGG - Intergenic
1108151563 13:47541214-47541236 ACCTGAGGAAATTTGATTTGTGG - Intergenic
1109796341 13:67318171-67318193 ACCCCAGGAGTTGTGCATTGTGG - Intergenic
1111703999 13:91725218-91725240 ACCGGAGTAGATAAGCATTAGGG + Intronic
1116203078 14:41824836-41824858 ACCTGTGGTGAAATGCACTGTGG + Intronic
1117032438 14:51687535-51687557 ACCTTAATAGATATGCCTTGGGG + Intronic
1117911245 14:60640369-60640391 ACCTGAGCTGATATGCATGTGGG - Intergenic
1119458966 14:74781958-74781980 AACTGAGGAGGTATCCCTTGTGG - Exonic
1119609279 14:76047941-76047963 ACCTGAGGAGCTATGGAGTCTGG + Intronic
1126326981 15:47489551-47489573 ACCTGAGAGGAGATGCATTGTGG - Intronic
1126755036 15:51917585-51917607 ACCAAAGGGAATATGCATTGAGG - Intronic
1132112575 15:99113055-99113077 ATCTGGGGAGAAATGCATTCTGG - Intronic
1134415935 16:14043404-14043426 ACCCGAGGAGAAATGCCTCGTGG - Intergenic
1135494618 16:22940627-22940649 AGATGAGGAGATAGGTATTGTGG - Intergenic
1135501686 16:23001229-23001251 ATCCGAGGAGAGAGGCATTGAGG - Intergenic
1136156901 16:28389066-28389088 ACCTGAGGTGAGATCCAATGAGG - Intronic
1136206185 16:28726215-28726237 ACCTGAGGTGAGATCCAATGAGG + Intronic
1142216119 16:88830860-88830882 GCCTGAGAAGATGTGCTTTGGGG + Intronic
1148102772 17:45102812-45102834 GCCTGAGGAGATATGCACGGGGG + Intronic
1149256579 17:54834373-54834395 ACCTAAGGGGAAATGCACTGTGG + Intergenic
1161895455 19:7076185-7076207 GCCTAAGGAGACAAGCATTGAGG + Intronic
1162174531 19:8821527-8821549 GCCTAAGGAGACAAGCATTGAGG - Intronic
1163129373 19:15263043-15263065 AGCTGAGGACATCTGCACTGTGG - Intronic
1164667780 19:30052804-30052826 ACCTGAGGAGAGATCCACAGGGG + Intergenic
1167364972 19:49049915-49049937 ATCTGAGGAGTTATGTATTAGGG + Intergenic
1167367220 19:49061079-49061101 ATCTGAGGAGTTATGTATTAGGG + Exonic
1167951263 19:53029632-53029654 ACCAGGGTAAATATGCATTGAGG + Intergenic
926774592 2:16409264-16409286 CCCTTAGCAGATATTCATTGGGG - Intergenic
927429000 2:23010616-23010638 GCATGAGGAGATATCCATTGTGG + Intergenic
930594173 2:53365755-53365777 ACCTGAGGATATCTGTATTTGGG + Intergenic
932796246 2:74698581-74698603 ACCTAACGAGATATCCTTTGAGG - Intergenic
932891513 2:75600976-75600998 ACCTGAGAAGAGAAGCCTTGAGG - Intergenic
935111340 2:100097216-100097238 ACCTGTGGAGAAAGGCATAGAGG - Intronic
936123628 2:109767948-109767970 ACCTGTGGAGAAAGGCATAGAGG + Intergenic
936221058 2:110603518-110603540 ACCTGTGGAGAAAGGCATAGAGG - Intergenic
937494047 2:122399334-122399356 ATCTGAGAAGAAACGCATTGGGG + Intergenic
940658030 2:156512393-156512415 ACATTATGAAATATGCATTGAGG - Intronic
941044167 2:160653539-160653561 AGCTGAGGAGATAGGGACTGAGG + Intergenic
1175528626 20:59657333-59657355 AGCAGAGGAAATATGCATTCAGG + Intronic
1177557690 21:22713591-22713613 TCCTGAGCACATATGCATTGTGG - Intergenic
1177766394 21:25462199-25462221 CCCTGAGTATATAAGCATTGAGG - Intergenic
1179137805 21:38696040-38696062 ACCTGATCAGATTTGCATTCTGG + Intergenic
1179225764 21:39451728-39451750 ACCTGTGCAGAGATGCCTTGGGG - Intronic
1182467229 22:30525098-30525120 ACCTCAGGACATCTGCAGTGAGG + Exonic
1184771870 22:46601900-46601922 ACCTCTGGAGATATGAACTGGGG - Intronic
949658337 3:6247863-6247885 ACCTGAGGAGCAATACATAGCGG - Intergenic
950907919 3:16555695-16555717 TTCTGAGGAGATAAGAATTGAGG + Intergenic
951532132 3:23707692-23707714 ACCTGAGGTGATATGTCTTTGGG - Intergenic
953440020 3:42908889-42908911 ACCTGAGGAGATGCCCCTTGGGG - Exonic
953666694 3:44930703-44930725 ACCTGAGGAGATATGCATTGTGG - Intronic
954241918 3:49300465-49300487 ACCTGAGTAGGTCTGCAGTGAGG + Exonic
960177946 3:114539463-114539485 ACCTTAGGACATAAGCAATGTGG + Intronic
961105575 3:124238172-124238194 AACTGTGGAGACATGGATTGTGG - Intronic
963617305 3:147557827-147557849 CTCTGAGGAGATATGGAATGAGG - Intergenic
967263397 3:187668009-187668031 ACCTAAAGAGATATCCTTTGGGG - Intergenic
969836232 4:9844210-9844232 ACAAGAGGTGATATGGATTGAGG + Intronic
971348328 4:25832682-25832704 TCCTGGGGAGATAGGCTTTGTGG - Intronic
971560278 4:28070853-28070875 AATTGAGAAGAAATGCATTGGGG + Intergenic
976048776 4:80985030-80985052 ACCTCAGGAGAAAAGCATTTGGG + Intergenic
982691586 4:158553543-158553565 ACCCGTGGAGAGATGCACTGTGG + Intronic
983332606 4:166350521-166350543 ACATGAAGTGAAATGCATTGTGG + Intergenic
986247620 5:6025117-6025139 ACCTCAGGAGAGAGGCAATGCGG + Intergenic
989814790 5:45722715-45722737 ACCTGAGGAGGTATACACAGAGG + Intergenic
991932335 5:71765998-71766020 GCCTGAGGAGATTTTCAATGTGG + Intergenic
993532793 5:89044691-89044713 ACCTGAAGAAATATGAAGTGAGG + Intergenic
994434870 5:99714779-99714801 ACCTCAGGTGATATGCACTGTGG - Intergenic
995501905 5:112816358-112816380 ACATGAGTAAATATGTATTGAGG + Intronic
996893543 5:128453098-128453120 ACATGAGTAGATATTCATTCTGG - Intronic
1001600727 5:172926488-172926510 ACCTGTGGAAAAATGCAGTGAGG - Exonic
1003323013 6:5069427-5069449 AGCTGATGATATATGTATTGTGG - Intergenic
1008013999 6:46497410-46497432 ACAGGAGGAAATATGTATTGTGG - Intergenic
1008262177 6:49380328-49380350 ACCTCATGAGATATGAATTGAGG - Intergenic
1008380598 6:50836245-50836267 CGCCGAGGAGAGATGCATTGAGG - Exonic
1009730997 6:67606577-67606599 ACTTGAGGAAATATTCTTTGTGG - Intergenic
1010825043 6:80462915-80462937 ACCTGAGGATATGTTCATGGTGG - Intergenic
1015608704 6:134990311-134990333 AACAGAGAAGATATACATTGTGG - Intronic
1018616481 6:165691685-165691707 TCCTGAGGACATCTGCACTGAGG - Intronic
1019224751 6:170500647-170500669 ACCTGTGCAGAAAAGCATTGGGG - Intergenic
1020814577 7:12889517-12889539 ACTGGAGGAAATATTCATTGAGG - Intergenic
1021326044 7:19270183-19270205 AGCTGAGGAGATAGAAATTGAGG + Intergenic
1022233621 7:28439683-28439705 ATCTTAGGAGATAGGCAGTGTGG - Intronic
1024454815 7:49593122-49593144 AGCTGATGAGATATGGATCGAGG + Intergenic
1029353784 7:100034951-100034973 ACTTGTGGAGAAATGCATTTAGG - Exonic
1031466812 7:122123254-122123276 AGCTGAGGAGATAGGAGTTGGGG - Intronic
1034893853 7:154862710-154862732 GCCAGAGGAGTTGTGCATTGAGG - Intronic
1034949560 7:155287830-155287852 GCCTGAAGAGCTATGCAGTGGGG + Intergenic
1038725213 8:30076180-30076202 AACTGAAGGGATTTGCATTGGGG + Intronic
1042917450 8:73889431-73889453 TTCTGAGGAGATAAGAATTGAGG + Intergenic
1043038123 8:75224496-75224518 ACCTGAAGAAATAAGCAGTGGGG + Intergenic
1043564777 8:81535681-81535703 ACTTGAGAAAATATGCAATGAGG - Intergenic
1044003678 8:86916147-86916169 TCCTGAGGAGACAAGCATTGAGG - Intronic
1044814139 8:96093367-96093389 ACGTGAGGAGGGAGGCATTGTGG - Intergenic
1045294190 8:100859864-100859886 TTCTGAGGAGAAATGCATTTTGG - Intergenic
1046620247 8:116521592-116521614 ACCTGTGTAGATATGCAATTTGG - Intergenic
1051129837 9:13848137-13848159 TCCTGAGGAAATATGAATGGTGG - Intergenic
1053315135 9:37044532-37044554 ACCAAAGGAGAAATGCATTTAGG - Intergenic
1057788731 9:98108524-98108546 GCCTGAGCAGATATGGTTTGAGG - Intronic
1059869157 9:118551829-118551851 AGCTGAGGTGATAAGCATTTAGG - Intergenic
1061302386 9:129712980-129713002 ACCTCCTGAGAAATGCATTGTGG - Intronic
1186429887 X:9496253-9496275 ACCTTATCAGTTATGCATTGTGG - Intronic
1187204152 X:17166218-17166240 ACCAGAGGAGAAATACATTCAGG - Intergenic
1187768736 X:22671545-22671567 AGCTGAGGAGAAGGGCATTGCGG - Intergenic
1189030382 X:37443285-37443307 ACCTCAGGACATTTGCAGTGGGG + Intronic
1192427364 X:71089143-71089165 ACCTGAGGAATGAAGCATTGTGG + Intergenic
1194361518 X:92957006-92957028 ACCTGAGAGGATGTGTATTGTGG + Intergenic
1195516427 X:105781400-105781422 ACCTAAGCAGATATGCTTTAAGG - Intergenic
1195623411 X:106982526-106982548 TCCTCAGGGCATATGCATTGGGG - Intronic
1197343308 X:125300522-125300544 AGCAGAGAAGATATGCCTTGTGG - Intergenic
1197422995 X:126261616-126261638 AACTGAGTAGAGATGCATAGGGG - Intergenic
1200669711 Y:6072881-6072903 ACCTGAGAGGATGTGTATTGTGG + Intergenic