ID: 953667848

View in Genome Browser
Species Human (GRCh38)
Location 3:44938833-44938855
Sequence GCTACAAGTGAGCACCGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 69}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953667848_953667854 25 Left 953667848 3:44938833-44938855 CCACCACGGTGCTCACTTGTAGC 0: 1
1: 0
2: 0
3: 8
4: 69
Right 953667854 3:44938881-44938903 AAGCCTCGCATGAACTTTGGTGG 0: 1
1: 0
2: 1
3: 6
4: 363
953667848_953667853 22 Left 953667848 3:44938833-44938855 CCACCACGGTGCTCACTTGTAGC 0: 1
1: 0
2: 0
3: 8
4: 69
Right 953667853 3:44938878-44938900 TCAAAGCCTCGCATGAACTTTGG 0: 1
1: 0
2: 1
3: 6
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953667848 Original CRISPR GCTACAAGTGAGCACCGTGG TGG (reversed) Intronic
920670772 1:208002357-208002379 GCTAGAAGTGCCCACCGTGATGG - Intergenic
922545729 1:226455378-226455400 GCTCCAAGTCAGAACTGTGGGGG - Intergenic
923046692 1:230361185-230361207 GCAACACATGAGCACTGTGGAGG - Intronic
924290812 1:242534551-242534573 GCTACAAGTGCTCACAGTAGAGG - Intergenic
1074910825 10:117906607-117906629 GGTAAAAGTGAAGACCGTGGAGG + Intergenic
1085505616 11:77056920-77056942 GTTACAAATTAGCACCGAGGAGG - Intergenic
1089288554 11:117423273-117423295 GCAACAACTGTGCACTGTGGAGG + Intergenic
1090310504 11:125732540-125732562 GCTCCAGGTGAGCAACATGGAGG + Intergenic
1091404040 12:197884-197906 GCTACAAGTGAGAACAGCGTGGG - Exonic
1091907279 12:4199349-4199371 GCTAGAAGGAAGCACGGTGGTGG - Intergenic
1094650070 12:32367696-32367718 GCTAGTTGTGAGCACTGTGGCGG - Exonic
1096895001 12:54812603-54812625 GGTACAAGTGCACACCGTGCAGG + Intergenic
1098305641 12:69099927-69099949 GGTACAGGTGAGCCCAGTGGAGG + Intergenic
1098584454 12:72139502-72139524 GCTACACATGAACACCGAGGAGG - Intronic
1098712268 12:73777690-73777712 GCTAAAACTGAGCACCATGGTGG - Intergenic
1100613556 12:96212782-96212804 GCTACCGGTGAGCCACGTGGCGG + Intronic
1103596617 12:122028037-122028059 GCACCAAGTGAGCACCCAGGAGG - Intronic
1122815877 14:104313767-104313789 GCTACAAAAGAGCACCCTGAGGG + Intergenic
1130201845 15:81838259-81838281 ACTACAGGTGAGCACAGTGTAGG - Intergenic
1130223691 15:82043126-82043148 GCTGCTAGTGCGCACCGTGCTGG - Exonic
1130707063 15:86243411-86243433 GCTACAAGTCAGGCCCTTGGAGG + Intronic
1138387771 16:56647994-56648016 GCTGCCAGTGCGCACCCTGGGGG - Intronic
1138515650 16:57534308-57534330 GCTACCAGTGAGCACAGCTGTGG - Intronic
1139591652 16:67936382-67936404 GTTCCAAGTGAGCAGCGGGGAGG - Exonic
1150606645 17:66697273-66697295 GCTAGATGTCAGCACAGTGGTGG + Intronic
1156598022 18:38570360-38570382 GGAATGAGTGAGCACCGTGGTGG + Intergenic
1160273215 18:77407020-77407042 ACTACAAGTGAGCTCCATGGAGG - Intergenic
1160348489 18:78153911-78153933 GCTCAAAGAGAGTACCGTGGTGG - Intergenic
1163299499 19:16434835-16434857 GGTACAAGTGGGCTCCTTGGAGG - Intronic
1166047037 19:40235791-40235813 CCTACAAGCGAGCACCCTTGTGG + Intronic
1167094815 19:47369531-47369553 GTTACATGTGAGCTCCGTGAGGG - Intronic
929165322 2:38875866-38875888 GCTCCAAGTGAGAATCGTGAGGG - Exonic
931908591 2:66869776-66869798 GCTGCAAGTGAAAACCCTGGGGG + Intergenic
935631412 2:105215571-105215593 GCTACAAGGGAGCAAAGAGGTGG - Intergenic
937930737 2:127203223-127203245 GGTTCACGTTAGCACCGTGGAGG + Intronic
941903871 2:170702731-170702753 CCTACTAGTAAGCACAGTGGTGG - Intergenic
948679794 2:239626045-239626067 GCTAAAAGTGAGGCCCGGGGCGG + Intergenic
1171369413 20:24651868-24651890 GCTAGCAGTGACCACCGTGCTGG + Intronic
1173565027 20:44032444-44032466 GCTAGAAGAGAGCCCTGTGGTGG + Intronic
1173833863 20:46112471-46112493 GCTACAAGAGAGGACAGTGGCGG + Intergenic
1173882196 20:46423931-46423953 GCAACAAGTCACCACCTTGGAGG - Intronic
1183305830 22:37082574-37082596 GCTTCAAGTGAGCTCCATGAGGG + Intronic
953667848 3:44938833-44938855 GCTACAAGTGAGCACCGTGGTGG - Intronic
953969581 3:47336677-47336699 GCTACGGCTGAGCACTGTGGAGG + Exonic
962657574 3:137563985-137564007 GATAGAAGTGAGCACATTGGTGG - Intergenic
964046817 3:152338414-152338436 GCTACAGTTGAGCACCGTGCTGG + Intronic
969291664 4:6243941-6243963 GCTACACTTGAGCACCTGGGAGG - Intergenic
969534181 4:7745915-7745937 GCTACAGGTGAGCTCCGGGGGGG + Intergenic
970039337 4:11778399-11778421 GCTACAAGTGAGCATCCAGATGG + Intergenic
970370075 4:15397264-15397286 GCTTCAAGTGAGCTCAGAGGTGG + Intronic
970584029 4:17498018-17498040 GCTACAGTTGGGCACAGTGGGGG - Intronic
977858187 4:101921739-101921761 ACTACAAGTGAACACAGTGGTGG - Intronic
978002896 4:103578600-103578622 GCAACAACTTAGCACTGTGGGGG - Intergenic
983834203 4:172369548-172369570 GCTGCATGGGAGCACCCTGGGGG + Intronic
992970304 5:82049586-82049608 TATACAAGTGAGCACAGTTGTGG + Intronic
1001808225 5:174607451-174607473 CATACAACAGAGCACCGTGGAGG + Intergenic
1005648350 6:27864050-27864072 GCTCCAAGTGAGCTCCTTGCTGG - Intronic
1012787360 6:103647807-103647829 GATACATGTGAGGAACGTGGAGG - Intergenic
1013410580 6:109880143-109880165 GGTACATGTGCGCAACGTGGAGG + Intergenic
1017738569 6:157384194-157384216 GCCACAAGTGTGCTCCATGGAGG + Intronic
1017781540 6:157719179-157719201 CCTAGAAGTGAGCACAATGGTGG - Intronic
1018313997 6:162538965-162538987 TCTCCAAGTGATTACCGTGGGGG + Intronic
1022785343 7:33632411-33632433 GCCACAAGTGAGCACCGCCTTGG + Intergenic
1025249239 7:57341023-57341045 ACTAAAAGTGAGCACCAAGGGGG - Intergenic
1027798569 7:82723661-82723683 GCTACAATTGAGCAAAGTTGAGG - Intergenic
1032080539 7:128856429-128856451 GCTTACAGTGAGCACCGTGTGGG + Intronic
1033448420 7:141441551-141441573 GCTACAAGTGAGAAGGGTGGGGG + Intronic
1033916700 7:146334966-146334988 ACTACAAGTGATCAAAGTGGAGG - Intronic
1035893849 8:3375075-3375097 GTTACAGTTGGGCACCGTGGAGG - Intronic
1046383223 8:113476693-113476715 GGTACAAGTGTGCAACGTGCAGG + Intergenic
1049591876 8:143466387-143466409 GCTGCAGGCCAGCACCGTGGAGG + Intronic
1061400458 9:130365508-130365530 GCTCCAAGTGGGCAGCTTGGGGG + Intronic
1186395263 X:9201795-9201817 GCTACAAGTGAGGACATTGGAGG - Intergenic
1187553312 X:20327360-20327382 GTTCCAAGGGAGCACCATGGTGG + Intergenic
1189893057 X:45625671-45625693 GCTACAAGTGCACAACGTGCAGG + Intergenic
1191945031 X:66524314-66524336 GGTACAAGTGCACAACGTGGAGG + Intergenic
1195988350 X:110657249-110657271 GCTAGCAGTGAGCAACGTGTGGG - Intergenic
1197085575 X:122470103-122470125 GCTACAAGTAACCACAGTAGCGG + Intergenic