ID: 953669137

View in Genome Browser
Species Human (GRCh38)
Location 3:44947987-44948009
Sequence CACAGCTATGGCATTGGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 203}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953669131_953669137 0 Left 953669131 3:44947964-44947986 CCACACCTGACACGAGGTCAAGC 0: 1
1: 0
2: 0
3: 4
4: 84
Right 953669137 3:44947987-44948009 CACAGCTATGGCATTGGACTGGG 0: 1
1: 0
2: 1
3: 4
4: 203
953669132_953669137 -5 Left 953669132 3:44947969-44947991 CCTGACACGAGGTCAAGCCACAG 0: 1
1: 0
2: 0
3: 4
4: 75
Right 953669137 3:44947987-44948009 CACAGCTATGGCATTGGACTGGG 0: 1
1: 0
2: 1
3: 4
4: 203
953669129_953669137 11 Left 953669129 3:44947953-44947975 CCAAACAAGAACCACACCTGACA 0: 1
1: 0
2: 1
3: 21
4: 167
Right 953669137 3:44947987-44948009 CACAGCTATGGCATTGGACTGGG 0: 1
1: 0
2: 1
3: 4
4: 203
953669128_953669137 12 Left 953669128 3:44947952-44947974 CCCAAACAAGAACCACACCTGAC 0: 1
1: 0
2: 2
3: 15
4: 147
Right 953669137 3:44947987-44948009 CACAGCTATGGCATTGGACTGGG 0: 1
1: 0
2: 1
3: 4
4: 203
953669127_953669137 18 Left 953669127 3:44947946-44947968 CCAGCTCCCAAACAAGAACCACA 0: 1
1: 0
2: 0
3: 25
4: 251
Right 953669137 3:44947987-44948009 CACAGCTATGGCATTGGACTGGG 0: 1
1: 0
2: 1
3: 4
4: 203
953669125_953669137 28 Left 953669125 3:44947936-44947958 CCTGCTTGGCCCAGCTCCCAAAC 0: 1
1: 0
2: 0
3: 11
4: 231
Right 953669137 3:44947987-44948009 CACAGCTATGGCATTGGACTGGG 0: 1
1: 0
2: 1
3: 4
4: 203
953669126_953669137 19 Left 953669126 3:44947945-44947967 CCCAGCTCCCAAACAAGAACCAC 0: 1
1: 0
2: 1
3: 19
4: 185
Right 953669137 3:44947987-44948009 CACAGCTATGGCATTGGACTGGG 0: 1
1: 0
2: 1
3: 4
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953669137 Original CRISPR CACAGCTATGGCATTGGACT GGG Intronic
902533169 1:17103406-17103428 CACAGTGATGGCATTGAACATGG - Intronic
905356141 1:37386263-37386285 CACAGCCCTGGCTTTGGAATTGG - Intergenic
907636831 1:56143734-56143756 CTCAGCTATGACATTGGCTTTGG - Intergenic
908727910 1:67196708-67196730 GATAGCTATGGCAATGGTCTAGG - Intronic
911550647 1:99275594-99275616 CTCAGCTTTGGCTTTGGCCTTGG + Intronic
912365594 1:109131155-109131177 CACAGCTATGGCAGGGGCCTTGG + Intronic
912527719 1:110297079-110297101 AAAAGATAGGGCATTGGACTTGG + Intergenic
913605812 1:120464747-120464769 CACAGGTATGGCCTGAGACTAGG - Intergenic
913643230 1:120832359-120832381 CACAGGTATGGCCTGAGACTAGG - Intronic
913643531 1:120835001-120835023 CACAGGTATGGCCTGAGACTAGG - Intronic
913643997 1:120839116-120839138 CACAGGTATGGCCTGAGACTAGG - Intronic
914177649 1:145292983-145293005 CACAGGTATGGCCTGAGACTAGG + Intronic
914178739 1:145302503-145302525 CACAGGTATGGCCTGAGACTAGG + Intronic
914179117 1:145305672-145305694 CACAGGTATGGCCTGAGACTAGG + Intronic
914179493 1:145308855-145308877 CACAGGTATGGCCTGAGACTAGG + Intronic
914180037 1:145313611-145313633 CACAGGTATGGCCTGAGACTAGG + Intronic
914180582 1:145318383-145318405 CACAGGTATGGCCTGAGACTAGG + Intronic
914181125 1:145323145-145323167 CACAGGTATGGCCTGAGACTAGG + Intronic
914181668 1:145327893-145327915 CACAGGTATGGCCTGAGACTAGG + Intronic
914182213 1:145332660-145332682 CACAGGTATGGCCTGAGACTAGG + Intronic
914182758 1:145337416-145337438 CACAGGTATGGCCTGAGACTAGG + Intronic
914183303 1:145342166-145342188 CACAGGTATGGCCTGAGACTAGG + Intronic
914183847 1:145346924-145346946 CACAGGTATGGCCTGAGACTAGG + Intronic
914184391 1:145351696-145351718 CACAGGTATGGCCTGAGACTAGG + Intronic
914184935 1:145356458-145356480 CACAGGTATGGCCTGAGACTAGG + Intronic
914185480 1:145361205-145361227 CACAGGTATGGCCTGAGACTAGG + Intronic
914186026 1:145365959-145365981 CACAGGTATGGCCTGAGACTAGG + Intronic
914186572 1:145370719-145370741 CACAGGTATGGCCTGAGACTAGG + Intronic
914187116 1:145375467-145375489 CACAGGTATGGCCTGAGACTAGG + Intronic
914187659 1:145380219-145380241 CACAGGTATGGCCTGAGACTAGG + Intronic
914188204 1:145384973-145384995 CACAGGTATGGCCTGAGACTAGG + Intronic
914188747 1:145389723-145389745 CACAGGTATGGCCTGAGACTAGG + Intronic
914269546 1:146067781-146067803 CACAGGTATGGCCTGAGACTAGG + Intronic
914269900 1:146070926-146070948 CACAGGTATGGCCTGAGACTAGG + Intronic
914270441 1:146075648-146075670 CACAGGTATGGCCTGAGACTAGG + Intronic
914270977 1:146080384-146080406 CACAGGTATGGCCTGAGACTAGG + Intronic
914271515 1:146085120-146085142 CACAGGTATGGCCTGAGACTAGG + Intronic
914272050 1:146089841-146089863 CACAGGTATGGCCTGAGACTAGG + Intronic
914272586 1:146094559-146094581 CACAGGTATGGCCTGAGACTAGG + Intronic
914273124 1:146099281-146099303 CACAGGTATGGCCTGAGACTAGG + Intronic
914273663 1:146104003-146104025 CACAGGTATGGCCTGAGACTAGG + Intronic
914274201 1:146108721-146108743 CACAGGTATGGCCTGAGACTAGG + Intronic
914274737 1:146113431-146113453 CACAGGTATGGCCTGAGACTAGG + Intronic
914275270 1:146118149-146118171 CACAGGTATGGCCTGAGACTAGG + Intronic
914275807 1:146122885-146122907 CACAGGTATGGCCTGAGACTAGG + Intronic
914532379 1:148534462-148534484 CACAGGTATGGCCTGAGACTAGG + Intronic
914532738 1:148537613-148537635 CACAGGTATGGCCTGAGACTAGG + Intronic
914533273 1:148542333-148542355 CACAGGTATGGCCTGAGACTAGG + Intronic
914533808 1:148547047-148547069 CACAGGTATGGCCTGAGACTAGG + Intronic
914534344 1:148551755-148551777 CACAGGTATGGCCTGAGACTAGG + Intronic
914534880 1:148556469-148556491 CACAGGTATGGCCTGAGACTAGG + Intronic
914535415 1:148561186-148561208 CACAGGTATGGCCTGAGACTAGG + Intronic
914535952 1:148565922-148565944 CACAGGTATGGCCTGAGACTAGG + Intronic
914536487 1:148570644-148570666 CACAGGTATGGCCTGAGACTAGG + Intronic
914536846 1:148573832-148573854 CACAGGTATGGCCTGAGACTAGG + Intronic
914585392 1:149057114-149057136 CACAGGTATGGCCTGAGACTAGG + Intronic
914585756 1:149060302-149060324 CACAGGTATGGCCTGAGACTAGG + Intronic
914628719 1:149488383-149488405 CACAGGTATGGCCTGAGACTAGG - Intergenic
914629073 1:149491510-149491532 CACAGGTATGGCCTGAGACTAGG - Intergenic
914629606 1:149496273-149496295 CACAGGTATGGCCTGAGACTAGG - Intergenic
914630141 1:149501028-149501050 CACAGGTATGGCCTGAGACTAGG - Intergenic
914630675 1:149505789-149505811 CACAGGTATGGCCTGAGACTAGG - Intergenic
914631206 1:149510550-149510572 CACAGGTATGGCCTGAGACTAGG - Intergenic
914631738 1:149515306-149515328 CACAGGTATGGCCTGAGACTAGG - Intergenic
914632274 1:149520059-149520081 CACAGGTATGGCCTGAGACTAGG - Intergenic
914632812 1:149524816-149524838 CACAGGTATGGCCTGAGACTAGG - Intergenic
914633345 1:149529545-149529567 CACAGGTATGGCCTGAGACTAGG - Intergenic
914633881 1:149534296-149534318 CACAGGTATGGCCTGAGACTAGG - Intergenic
914634418 1:149539047-149539069 CACAGGTATGGCCTGAGACTAGG - Intergenic
914634951 1:149543784-149543806 CACAGGTATGGCCTGAGACTAGG - Intergenic
914635486 1:149548521-149548543 CACAGGTATGGCCTGAGACTAGG - Intergenic
914636021 1:149553258-149553280 CACAGGTATGGCCTGAGACTAGG - Intergenic
916688997 1:167172857-167172879 CTCAGATATGACTTTGGACTTGG + Intergenic
917222157 1:172743406-172743428 CACATCTATGGGAATGGAGTTGG + Intergenic
917517140 1:175717718-175717740 CACAGCAAGGGCCTTTGACTAGG - Intronic
919081558 1:192872686-192872708 CACATCTCTAGCATTGAACTTGG - Intergenic
921552750 1:216558269-216558291 CACAACTATGGCATCGAAATAGG - Intronic
924257349 1:242195646-242195668 CACAGCCATGGCAGTGGCCGAGG - Intronic
1063728169 10:8663409-8663431 CACACCTATGGCATAAGGCTTGG + Intergenic
1067429601 10:46234379-46234401 CACTGTGATGGCATTGGAATTGG + Intergenic
1068695800 10:59967081-59967103 CAGAGCTATGGCAATGCAGTAGG - Intergenic
1068726869 10:60312851-60312873 CACAGCTATGGCCTAGAGCTGGG + Intronic
1070172356 10:73942226-73942248 CACAGCCATGGCAAGGGTCTGGG - Intergenic
1070692414 10:78536962-78536984 TACAGATATGGAATGGGACTTGG - Intergenic
1070717532 10:78733405-78733427 CACAGCTATGGCTTTGCTCTTGG - Intergenic
1071054764 10:81496363-81496385 AACAGTTATGGCATTGGAAATGG + Intergenic
1076929283 10:133518978-133519000 AAATGCTATGGCATTGGACCAGG + Intergenic
1077699105 11:4423511-4423533 TACAGCTATAGCAATGGATTGGG - Intergenic
1077799841 11:5526690-5526712 CACAGCTCTGGAAATGGACATGG - Intronic
1078956265 11:16198830-16198852 CACAGCAAAGGCTTTGAACTTGG - Intronic
1079686885 11:23370528-23370550 AAGAGCCATGGCATTGAACTGGG - Intergenic
1079860142 11:25659007-25659029 CACAGCTAAGGCCTTGGTTTAGG - Intergenic
1085718115 11:78890659-78890681 CACAGCTTTCACCTTGGACTTGG - Intronic
1086779798 11:90888979-90889001 TACAACTATAGCAATGGACTTGG - Intergenic
1087701151 11:101438268-101438290 CATAACTATGGCATTGGAGATGG - Intergenic
1087889699 11:103523195-103523217 CACATCTTAGGCATTGGACGAGG - Intergenic
1088592183 11:111413398-111413420 CACTGCTTTGGCATGGGCCTTGG + Intronic
1091011953 11:132009510-132009532 CACAGCCAGGGCACTGGACCAGG - Intronic
1091702682 12:2674297-2674319 GACAGGAATGGCATTGGACGGGG + Intronic
1098771494 12:74559103-74559125 CTCAGATAAGGCTTTGGACTTGG - Intergenic
1101727227 12:107398143-107398165 CACAGCTCTGGCATTGGGTTGGG + Intronic
1102238055 12:111307093-111307115 CACTTCTATGGCCTCGGACTTGG - Exonic
1113269073 13:108653458-108653480 GACATTTATGACATTGGACTTGG - Intronic
1113633134 13:111901516-111901538 CCCAGCACTGGCATTGGAGTCGG + Intergenic
1118108770 14:62692771-62692793 GAAAGTTATAGCATTGGACTGGG + Intergenic
1122860293 14:104579500-104579522 CACAGCTCTGGAATTGACCTGGG + Intronic
1127614329 15:60668548-60668570 AACAGCTATTTCATTGGCCTCGG + Intronic
1128803975 15:70517160-70517182 CACAGATATGGCTAGGGACTTGG - Intergenic
1131350378 15:91694260-91694282 AACAGCTGTGGGATTGGAATAGG - Intergenic
1131524186 15:93139594-93139616 CTCAGCTCTGGCACTGGGCTTGG - Intergenic
1135162647 16:20110999-20111021 CCCACCATTGGCATTGGACTGGG - Intergenic
1135384697 16:22027396-22027418 CACACCTGTGGAATTAGACTTGG + Intronic
1135675825 16:24414097-24414119 CAGAGTTATGGAATTGAACTGGG + Intergenic
1138316575 16:56075561-56075583 AACAGCTATGGAATAAGACTGGG - Intergenic
1141478496 16:84290294-84290316 CACAGCCATGACTTTGGCCTTGG + Intergenic
1144637735 17:16920967-16920989 CAAAGATATGGCATTAGCCTGGG + Intergenic
1149644653 17:58231318-58231340 TCCAGCTCTGGCATTGGAGTTGG - Intronic
1150590628 17:66559089-66559111 GACAGCTCTTGCACTGGACTGGG + Intronic
1156376882 18:36522732-36522754 CACAGCCATGGCATGGCTCTGGG - Intronic
1157204084 18:45683843-45683865 CACAGAAATGACCTTGGACTTGG + Intergenic
1163929788 19:20377913-20377935 CACAGCTATGTCATGGGGTTTGG + Intergenic
1164506481 19:28865408-28865430 CACAGCCCTGGCATGGGAGTTGG - Intergenic
926112821 2:10193692-10193714 CCCAGTTAGGGCATGGGACTTGG - Intronic
926384631 2:12324043-12324065 GACACCAATTGCATTGGACTAGG + Intergenic
930314113 2:49776491-49776513 CACACCAATGGCATTGTAGTTGG - Intergenic
930507840 2:52305989-52306011 CTCAGATATGACTTTGGACTTGG + Intergenic
936601234 2:113896923-113896945 AACAGCTAAAGGATTGGACTAGG + Intronic
937627108 2:124055916-124055938 CAGAGCCATGGCAGTGGACATGG - Intronic
940201077 2:151151543-151151565 CACAGCTATGGCTTCAGAATAGG + Intergenic
941432236 2:165426819-165426841 CCCAGCTGTGGCTTTGGACCCGG + Intergenic
942898810 2:181089844-181089866 CACAGCTAGAGCACTGTACTGGG - Intergenic
943570216 2:189565053-189565075 CAAAGCTAAGTCATAGGACTGGG - Intronic
944350816 2:198724735-198724757 CACAGCTGTGGCCATGGAATAGG - Intergenic
945303121 2:208233110-208233132 CAAAATGATGGCATTGGACTGGG - Intergenic
945468282 2:210196881-210196903 CACAGCTGTGGCTTTGGACTTGG - Intronic
946495486 2:220192024-220192046 CCCAGCAATGGCTCTGGACTTGG + Intergenic
947572161 2:231244767-231244789 CACAGCAATGGCAGCGGGCTAGG - Intronic
1173077690 20:39835331-39835353 AACAGGTCTGGGATTGGACTTGG - Intergenic
1176371391 21:6063910-6063932 CACAGCCATGCCATGGGACATGG + Intergenic
1178098176 21:29237585-29237607 CACAGCTAAGTCAGTGGCCTTGG - Intronic
1179752128 21:43474629-43474651 CACAGCCATGCCATGGGACATGG - Intergenic
1181590845 22:23884003-23884025 CTCAGCTTTGGCATTGGCCCTGG + Exonic
1184176740 22:42793332-42793354 CACAGCCATGGCCTTGAGCTGGG - Intergenic
1184581736 22:45422581-45422603 CAGAGCTAAGGCACAGGACTGGG - Intronic
1184686084 22:46096955-46096977 CCCAGCTGTGGCATCAGACTTGG + Intronic
953013273 3:39048885-39048907 CACAGCTTTGGCTAAGGACTAGG + Intergenic
953669137 3:44947987-44948009 CACAGCTATGGCATTGGACTGGG + Intronic
959916290 3:111820144-111820166 CACAGCATTGGCAGGGGACTTGG + Intronic
965849573 3:173007740-173007762 CAAAGCTATTGAATTGAACTTGG + Intronic
965884098 3:173423396-173423418 CTCAGATAAGGCTTTGGACTTGG - Intronic
969597232 4:8156367-8156389 CACAGCTAGGACATTGGATTCGG + Intronic
971667342 4:29506533-29506555 AACACCTTAGGCATTGGACTGGG - Intergenic
972014862 4:34231352-34231374 CTCAGATAAGGCTTTGGACTTGG + Intergenic
978905268 4:113997802-113997824 CACAGCTAATGTATTGGAATAGG + Intergenic
981124101 4:141085901-141085923 CACTGAAATGGCATTAGACTAGG - Intronic
981144734 4:141311334-141311356 CAGAGTTCTGGGATTGGACTAGG - Intergenic
981490832 4:145337581-145337603 TACAGCTCTGGCCTGGGACTAGG - Intergenic
982368830 4:154610813-154610835 CATAGCTTTGGGAATGGACTGGG + Intronic
987112089 5:14697834-14697856 CACAGTCTTGGCAGTGGACTTGG + Exonic
991706052 5:69359921-69359943 CAAAGATATGACATTGGAGTTGG + Intronic
994926232 5:106120623-106120645 CACTGCTGTGGCATAGAACTGGG - Intergenic
996179391 5:120400227-120400249 CTCAGATAAGGCTTTGGACTTGG + Intergenic
996286000 5:121793125-121793147 CAGAACTCTGGCATTGCACTTGG + Intergenic
996578905 5:125007988-125008010 CTCGGATATGGCCTTGGACTTGG + Intergenic
997756680 5:136406248-136406270 CACAGCTGTGAGATTAGACTGGG + Intergenic
999638403 5:153646445-153646467 CACAGCTAGGACATATGACTTGG - Intronic
1002564190 5:180100709-180100731 CACAGTTCAGGCATGGGACTGGG - Intergenic
1003492110 6:6632123-6632145 CACAGGTGTGGCATTGTCCTTGG - Intronic
1003528135 6:6915385-6915407 CACAGCTCTGCCATTGCCCTGGG + Intergenic
1004441494 6:15659473-15659495 CAGAGCTATCACATTGGACCTGG - Intronic
1004613378 6:17267054-17267076 TACAGCTCAGGCAGTGGACTAGG + Intergenic
1006936888 6:37724872-37724894 AACAGGAAGGGCATTGGACTGGG - Intergenic
1007494011 6:42246728-42246750 CCCAGCTATGGCCTTGACCTTGG + Intronic
1010659675 6:78555736-78555758 CTTAGATATGGCTTTGGACTTGG - Intergenic
1012606320 6:101162231-101162253 CACAGGAAAGGCATTGTACTAGG + Intergenic
1018368182 6:163143769-163143791 CCCAGCCCTGGCATTGGACGTGG - Intronic
1018558244 6:165072576-165072598 CAGAGCTATGGCTGTGGACAGGG + Intergenic
1018592597 6:165443405-165443427 CAGAGCTGTGGCTGTGGACTTGG - Intronic
1019078054 6:169406901-169406923 CACAGCTGAGGTTTTGGACTTGG - Intergenic
1020087696 7:5320460-5320482 CACAGTTATGGCCATGGCCTTGG + Intronic
1022470255 7:30677638-30677660 CAGAGCTTTGGCATGGGATTTGG + Intronic
1025206618 7:56996706-56996728 CACAGTTATGGCCGTGGCCTTGG - Intergenic
1031998386 7:128247709-128247731 AACAGCTAAGGCATTGGGGTTGG + Intronic
1032166274 7:129547580-129547602 CAGGGCTTTGGCCTTGGACTGGG - Intergenic
1033430187 7:141282039-141282061 GACAGCTATGGCAGTGGTTTGGG + Intronic
1035515166 8:226573-226595 CATAGTTCTGGCATGGGACTTGG - Intergenic
1036928867 8:12933306-12933328 CACAGGTATGGAATTGGAAAAGG - Intergenic
1037518082 8:19653443-19653465 TACAGCTATGGGATTGGATGAGG - Intronic
1038760528 8:30381523-30381545 CACAGCAATGGCATTAGGCAGGG - Intergenic
1041977523 8:63816986-63817008 CTCAGATAAGACATTGGACTTGG - Intergenic
1042841552 8:73129451-73129473 CACACCTAAGGCATTCTACTGGG + Intergenic
1044066486 8:87705691-87705713 CTCAGGTAAGACATTGGACTTGG - Intergenic
1048553293 8:135453975-135453997 CAGCGCTATGGCAGTGGGCTGGG + Intergenic
1057737736 9:97680519-97680541 CAGAACAATGGCATTCGACTGGG - Intronic
1058930481 9:109714344-109714366 CACAACTATTGCCATGGACTGGG + Intronic
1061428753 9:130517929-130517951 CACAGTGAAGGCTTTGGACTAGG + Intergenic
1062732251 9:138116729-138116751 CACACCTCTGGCCTTGGACGTGG + Intronic
1188083641 X:25876602-25876624 CAAATCTAAGTCATTGGACTAGG - Intergenic
1191095173 X:56665862-56665884 CTCAGCTAAGACTTTGGACTTGG + Intergenic
1194125476 X:90011507-90011529 AAAAATTATGGCATTGGACTAGG - Intergenic
1194539867 X:95156838-95156860 CACAGCTGTGGCAATGTAATAGG - Intergenic
1194577307 X:95628260-95628282 CACAGCTATGGCAGTGAGCAGGG + Intergenic
1194969770 X:100330439-100330461 TATATCTCTGGCATTGGACTTGG + Intronic
1195480153 X:105335527-105335549 AAAAGCTATGGTATTGAACTGGG + Intronic
1197430413 X:126355826-126355848 CAGACCTTTGGCCTTGGACTGGG - Intergenic
1200966994 Y:9056217-9056239 CACAGCTCTGGTACAGGACTTGG + Intergenic
1201310498 Y:12594764-12594786 TTCAGCTTTGGCAATGGACTTGG + Intergenic
1202335557 Y:23806196-23806218 CACAGTTTTGGTATGGGACTTGG + Intergenic
1202535210 Y:25863863-25863885 CACAGTTTTGGTATGGGACTTGG - Intergenic