ID: 953672453

View in Genome Browser
Species Human (GRCh38)
Location 3:44974988-44975010
Sequence ATTGGGAGCCTACTATAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 86}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953672453 Original CRISPR ATTGGGAGCCTACTATAGAT AGG (reversed) Intronic
901749049 1:11394708-11394730 AAGGAGAGACTACTATAGATGGG - Intergenic
903285440 1:22273968-22273990 CTTGAGTGCCTACTATTGATGGG + Intergenic
903463179 1:23533559-23533581 ATTGAGAACCTACTATACACTGG + Intergenic
910210214 1:84784581-84784603 ATTGAGAGCTTACTATAGGTAGG - Intergenic
910457865 1:87417123-87417145 ATTAATAGCCTACTATGGATTGG + Intergenic
910853458 1:91670849-91670871 ATTGGGTGTCTACCATAGACTGG + Intergenic
911430506 1:97779968-97779990 ATTGGGTGCCTAATATATAATGG + Intronic
914228843 1:145745857-145745879 ATTGGGAGCCTTATGTTGATAGG - Exonic
921805322 1:219447361-219447383 ATGGGGAGGATTCTATAGATAGG - Intergenic
921823855 1:219649338-219649360 ATTGGGAGCTTACTATATTCTGG - Intergenic
922368097 1:224884911-224884933 ATTTGGAGCTTACTATAGCAAGG + Intergenic
924447549 1:244147906-244147928 ATTGATTGCCTAATATAGATGGG - Intergenic
924640536 1:245829281-245829303 ATTGGGAGCCTATTGTACACTGG + Intronic
1063737193 10:8771918-8771940 ATTAGGAGCAAAATATAGATAGG - Intergenic
1069098503 10:64289140-64289162 ATTGAGTGCCTACTATATTTTGG + Intergenic
1075311573 10:121418692-121418714 ATTTGGAGCCCACTATAAAAAGG - Intergenic
1078415962 11:11165058-11165080 ATTGGGAGGATGCTATAGCTTGG - Intergenic
1084375697 11:68775708-68775730 ATTGGGCACCTACTATGGGTTGG + Intronic
1085410233 11:76286472-76286494 TTTGGGAGGCAACTATAGAGAGG - Intergenic
1088399778 11:109410694-109410716 ATTGGAATTCTACTATACATTGG + Intergenic
1090536208 11:127644499-127644521 ATTGGGAACTTACTACATATCGG - Intergenic
1093805300 12:23425294-23425316 ATTAGTAGCCTACTGTTGATAGG - Intergenic
1095978231 12:47954342-47954364 ATTGAGGGCCTACTATGCATCGG + Intergenic
1100366658 12:93927644-93927666 ATTAAAAGCCTACTATAGACCGG + Intergenic
1100598650 12:96093155-96093177 ATGGGGAACCTGCTACAGATAGG + Intergenic
1100676001 12:96868793-96868815 ACTGGGAGTCAACCATAGATTGG + Intronic
1102014488 12:109638741-109638763 ATTGGGCACCTACTGTATATAGG + Intergenic
1110208801 13:72948464-72948486 ATTTGGAGCCTCCTAGAGACTGG - Intronic
1115323131 14:32106877-32106899 TTTGGGTGCCTACTATATGTCGG - Intronic
1120062312 14:79998881-79998903 ATTGCCAGCCTACTCTAGAATGG + Intergenic
1123848370 15:24327439-24327461 ATTTGGAGCTCACTATTGATTGG + Intergenic
1123867428 15:24534962-24534984 ATTTGGAGCTCACTATTGATTGG + Intergenic
1127758229 15:62113404-62113426 GTTGGGAGTCTAGTAAAGATGGG - Intergenic
1130702141 15:86195096-86195118 ATTGAGAGCTTACTATAGGCTGG + Intronic
1135337950 16:21619772-21619794 ATTGGGAGATTTCTATATATTGG + Intronic
1135865243 16:26095069-26095091 ATTGGGAGCATAATATATTTAGG - Intronic
1135875553 16:26196694-26196716 ATTGGCAGTCTACTATAAAGAGG + Intergenic
1138093634 16:54195549-54195571 ATGGGGAGCCTAGTGTAGACAGG - Intergenic
1139044017 16:63034268-63034290 CTTGGAGGCCTACTTTAGATAGG - Intergenic
1140493698 16:75364039-75364061 AGTGGGAACCTAATTTAGATTGG + Intronic
1140988906 16:80188960-80188982 ATTGGGAGCTTACAATATAGTGG - Intergenic
1144035904 17:11365857-11365879 TTGGGGAGCCTACAATAGATTGG + Intronic
1144760122 17:17702412-17702434 ATTGTGAGCCTACTGTATATGGG + Intronic
1146324612 17:31875128-31875150 ATTGAGAGCCAACTCTAGAGTGG - Intronic
1146939201 17:36832336-36832358 ATTGAGTGCCTACTATAGGCAGG + Intergenic
1149914515 17:60596915-60596937 ATTGGGTGGCTACGTTAGATTGG + Intergenic
1156560099 18:38115220-38115242 ATTGAGAGCTTATTAGAGATAGG - Intergenic
1162528466 19:11221570-11221592 ATTGTCAGCCTACAATAGATGGG - Intronic
1167569684 19:50279221-50279243 AATGGAATCCTACTATATATGGG + Intronic
930357575 2:50341415-50341437 ATTGGGAACCTACTATAGTCTGG + Intronic
934098031 2:88625901-88625923 ATCTGGAGACTACTATAAATAGG - Intronic
939244060 2:139599996-139600018 ATTGGGAGCCCAGTATAAAAAGG + Intergenic
941608348 2:167629011-167629033 ATTTGGAGCCTACCATAAATTGG + Intergenic
943103523 2:183514498-183514520 ATTAGTAGCCTGCTATTGATTGG - Intergenic
943129510 2:183838869-183838891 ATTGGGAGCCACCTAAAAATGGG + Intergenic
944646278 2:201783855-201783877 ATTGGTAGACTACTATGGACAGG - Intergenic
1170085776 20:12530070-12530092 ATAGGGAGACTAGTAAAGATGGG + Intergenic
1171933552 20:31251163-31251185 ATTGACAGCCTACTATTGACTGG - Intergenic
1172243584 20:33430166-33430188 ATTGAGCGCCTACTATATATTGG + Intronic
1172831695 20:37841053-37841075 ATTGAGTGACTACTATGGATTGG + Intronic
1174769041 20:53281184-53281206 AATGGAAGGCTACTTTAGATGGG + Intronic
1175032524 20:55970005-55970027 ATTGAGAACCTACTATTCATGGG - Intergenic
949430791 3:3973311-3973333 ATTGTGTGCCTACTACATATTGG + Intronic
951607328 3:24450716-24450738 AAGCTGAGCCTACTATAGATTGG - Intronic
953179054 3:40579821-40579843 ATTGAAAGCCTACCATATATTGG + Intergenic
953672453 3:44974988-44975010 ATTGGGAGCCTACTATAGATAGG - Intronic
958150019 3:89679654-89679676 ATTGCGAGCCTACTTTAGTTTGG - Intergenic
961747601 3:129075195-129075217 ATTGGAATTCTACTATTGATTGG - Intergenic
965850823 3:173020652-173020674 ATTGAGAGCCTATTATGGGTAGG + Intronic
970902622 4:21177128-21177150 ATTGAATGCCTACTATATATAGG + Intronic
971776119 4:30967802-30967824 ATTGGGGGTGTACTATAGATTGG - Intronic
975472724 4:74789114-74789136 ATTGAGCACCTACTATACATAGG + Intronic
981141442 4:141274281-141274303 ATTGTGAGCCTACTAAATACTGG + Intergenic
991200371 5:63984939-63984961 ATTTGGAGCCAACTGTAAATAGG - Intergenic
1004853305 6:19723343-19723365 ATTGTGAACCTACTATATACGGG - Intergenic
1007374522 6:41447234-41447256 ATTGAGAGCCTACTATGGGCTGG - Intergenic
1017759926 6:157560512-157560534 ATTGGGATCTTAATATATATAGG + Intronic
1024506072 7:50162938-50162960 ATTAGGAGCATACTATACAGGGG - Intergenic
1024850589 7:53711340-53711362 ACTAATAGCCTACTATAGATTGG - Intergenic
1030026273 7:105327693-105327715 ATTGGGCACCTACTATAAATGGG - Intronic
1030330432 7:108264621-108264643 ATTAGGAGACTAATAAAGATAGG - Intronic
1031353739 7:120765651-120765673 ATTTGTAGCCAACTATAGGTGGG - Intergenic
1033684156 7:143623422-143623444 ACTGGAAGACTACTTTAGATTGG - Intronic
1033687332 7:143702641-143702663 ACTGGAAGACTACTTTAGATTGG - Intronic
1033700456 7:143834201-143834223 ACTGGAAGACTACTTTAGATTGG + Intergenic
1040766868 8:50921892-50921914 ATTGAGTGCCTGCTATAGAAAGG + Intergenic
1041785793 8:61632088-61632110 ACTGGGAGCTTATTATAGGTCGG + Intronic
1042262391 8:66872637-66872659 ATTTGGCACCTACTATAGGTTGG - Intronic
1052536048 9:29748915-29748937 ATTGGAAGCCGACTCTAGAGTGG + Intergenic
1061322131 9:129837470-129837492 ATTGGATGCCGACTATAGCTGGG - Intronic
1188629786 X:32340454-32340476 GTTGAGAGCCTACTATGAATAGG + Intronic
1190123993 X:47687255-47687277 ATTGGGAGCCGACTCTGTATGGG + Intergenic
1191039480 X:56063895-56063917 ATAGGGAGCCTACTGCAGCTCGG - Intergenic
1193207720 X:78768297-78768319 ACTGGGTGTCTACTGTAGATTGG - Intergenic
1194440854 X:93931906-93931928 ATTGAGAATCTACTATAGCTAGG + Intergenic
1196022657 X:111006648-111006670 AATGGGGACCTGCTATAGATAGG + Intronic
1198673993 X:139112316-139112338 ATGGAGAGCCTACTATATGTTGG - Intronic