ID: 953672935

View in Genome Browser
Species Human (GRCh38)
Location 3:44977665-44977687
Sequence GTGTATACAAAAATATAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 389
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 363}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953672935_953672941 29 Left 953672935 3:44977665-44977687 CCCTGCTATATTTTTGTATACAC 0: 1
1: 0
2: 1
3: 24
4: 363
Right 953672941 3:44977717-44977739 ATTTTTTTAGGGACACATTACGG 0: 1
1: 1
2: 1
3: 29
4: 281
953672935_953672938 17 Left 953672935 3:44977665-44977687 CCCTGCTATATTTTTGTATACAC 0: 1
1: 0
2: 1
3: 24
4: 363
Right 953672938 3:44977705-44977727 TATCCTCAAAGTATTTTTTTAGG 0: 1
1: 0
2: 7
3: 52
4: 458
953672935_953672939 18 Left 953672935 3:44977665-44977687 CCCTGCTATATTTTTGTATACAC 0: 1
1: 0
2: 1
3: 24
4: 363
Right 953672939 3:44977706-44977728 ATCCTCAAAGTATTTTTTTAGGG 0: 1
1: 0
2: 4
3: 40
4: 483

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953672935 Original CRISPR GTGTATACAAAAATATAGCA GGG (reversed) Intronic
901883252 1:12206217-12206239 GTCTCTACAAAAAATTAGCAGGG + Intronic
902339536 1:15773972-15773994 GTGTCTACAAAAAATTAGCCGGG + Intronic
902913705 1:19622184-19622206 GTGTATACATATACGTAGCAGGG + Intronic
905008056 1:34726970-34726992 CTGTACACAAACATATGGCATGG + Intronic
907539674 1:55202134-55202156 ATGAATACAAAAATAAAGCATGG - Intronic
908907526 1:69033609-69033631 GAGTATGCAAAAATTTTGCATGG - Intergenic
909270150 1:73613556-73613578 GTGGGTACAAAAAAATAGAAAGG - Intergenic
910054707 1:83018889-83018911 ATGTATACACATATATAGCAGGG - Intergenic
910054710 1:83018931-83018953 ATATATACACATATATAGCAGGG - Intergenic
911308154 1:96257491-96257513 ATATATACAAAAATATAACTAGG - Intergenic
912328028 1:108787263-108787285 GTGTATATAAAAATCCAGCTAGG - Intronic
917862995 1:179165954-179165976 GTGAATACAAAAAATTAGCTGGG - Intronic
919088454 1:192949476-192949498 GTGTCTACAAAAAACTAGCCAGG + Intergenic
919688046 1:200502765-200502787 CTGTAGAGAAAAATAAAGCAGGG - Intergenic
921895507 1:220395641-220395663 CTGTAGATAAAAATAAAGCAGGG - Intergenic
922031451 1:221803855-221803877 GTGTCTACAAAAAATTAGCTGGG - Intergenic
923121504 1:230996603-230996625 GTCTCTACAAAAATTTAGCAGGG - Intronic
924083385 1:240422605-240422627 GCTAATACACAAATATAGCAAGG - Intronic
1063261457 10:4393809-4393831 AAGGATACAAAAATATATCAGGG - Intergenic
1063487095 10:6430158-6430180 GTGAAGTCAAAAATAAAGCAAGG - Intronic
1063923136 10:10951302-10951324 GTCTCTACAAAAATATAGCTGGG - Intergenic
1065364313 10:24920315-24920337 GTGTATATATATATATACCATGG + Intronic
1065609042 10:27452649-27452671 GTGGGTACAAAAATATAGTTAGG - Intergenic
1066676159 10:37889663-37889685 ATGTATACAAAGATATATCACGG - Intergenic
1067403206 10:45996802-45996824 GTCTATACAAAAAATTAGCCGGG + Intronic
1068082248 10:52333528-52333550 CTGTAGACACAAATATAGCAAGG - Intergenic
1068132669 10:52913978-52914000 GTACATCCAAAAATATAACAAGG - Intergenic
1069190623 10:65483709-65483731 GTGTATAATCAAATAAAGCAGGG - Intergenic
1069213064 10:65785919-65785941 GTGAATAACATAATATAGCAAGG - Intergenic
1070481436 10:76886816-76886838 GTGTATAAAAAAAGAAAGAAAGG + Exonic
1070536146 10:77378754-77378776 CTGTATGCAAACATAAAGCATGG + Intronic
1071872795 10:89813882-89813904 TTTTATACAAAAATACAGGAAGG - Intergenic
1072136361 10:92550488-92550510 GTGAATACAAAAAATTAGCCGGG + Intronic
1073978119 10:109123357-109123379 ATATATACAAAAATTTAGCTGGG + Intergenic
1074451432 10:113562856-113562878 GTGTACACAGTAATAAAGCAAGG - Intronic
1074645307 10:115443776-115443798 GTGTAGCAAAAAATATATCAAGG - Intronic
1078593334 11:12664949-12664971 CTCTATAAAAAAATATAGCCAGG + Intergenic
1078982735 11:16555627-16555649 TTGTATTCAATAGTATAGCAGGG - Intronic
1079462844 11:20699326-20699348 GTGTATACATATATATACCTTGG - Intronic
1079533541 11:21484128-21484150 TTATACAAAAAAATATAGCATGG - Intronic
1079557874 11:21783310-21783332 TTTTATGTAAAAATATAGCAAGG + Intergenic
1079796528 11:24810667-24810689 GTATGGACAAAAATAAAGCAGGG + Intronic
1079917291 11:26385247-26385269 GTGTTTACAAACATATAAAAGGG + Intronic
1080144973 11:28970592-28970614 ATTTATACAAAAATCTAGGATGG - Intergenic
1082077690 11:47987045-47987067 GTCTATACAAAAAATTAGCTGGG + Intronic
1082176197 11:49062371-49062393 TTGTTTAAAAAAGTATAGCAAGG + Intergenic
1082923861 11:58524970-58524992 GTGAATATAAACATATAGAAAGG - Intergenic
1085854113 11:80156744-80156766 ATGTATATAAGAATAGAGCAGGG - Intergenic
1085932419 11:81099741-81099763 GTACATAGAAAAATATAGAATGG + Intergenic
1086036113 11:82416955-82416977 GTGTGTATATAAATATAGAATGG - Intergenic
1086215257 11:84371414-84371436 GTCTATACAAAAAATTAGCCAGG - Intronic
1086689522 11:89773495-89773517 TTGTTTAAAAAAGTATAGCAAGG - Intergenic
1086716335 11:90066459-90066481 TTGTTTAAAAAAGTATAGCAAGG + Intergenic
1088168794 11:106971008-106971030 GTGAAGGCAAAACTATAGCATGG + Intronic
1088217236 11:107524509-107524531 TGGTATAGAAAAATAAAGCATGG - Intronic
1088471693 11:110194192-110194214 GTGTATTAAAAAATACAGCCTGG - Intronic
1088507989 11:110544624-110544646 TTTTATATTAAAATATAGCAGGG + Intergenic
1089082150 11:115785456-115785478 GTGTACACACAAATACAGCTGGG - Intergenic
1089448590 11:118573373-118573395 GAGTATACAAAGATAACGCATGG - Intronic
1090368317 11:126226810-126226832 GTGTCTACAAAAAATTAGCCAGG + Intronic
1090607751 11:128440293-128440315 ATATATTCAAAAATATATCAAGG + Intergenic
1090825857 11:130385377-130385399 GTATATACAACAATAAAGTATGG - Intergenic
1092668435 12:10833716-10833738 ATGAATACAAAAGTATAGCCAGG - Intronic
1092720085 12:11432872-11432894 GTGTATACAGAAAGAGAGAAGGG - Intronic
1093201860 12:16197416-16197438 GGGTATAAAAAGATATAGAAAGG + Intronic
1095667071 12:44814774-44814796 GTGGAGAACAAAATATAGCAAGG - Intronic
1098082427 12:66802615-66802637 GTTTCTACAAACATATATCATGG + Intronic
1100233925 12:92638206-92638228 AAATATACAAAAATATAGCTAGG + Intergenic
1100791536 12:98135606-98135628 GTGCCTACAAAATTCTAGCATGG + Intergenic
1100957488 12:99925146-99925168 GTGGATACAAAACTAGAGCTAGG + Intronic
1101630069 12:106484602-106484624 GTGTAAACAAAAATATAAACAGG + Intronic
1101739274 12:107487709-107487731 GTGTGTGCAAAAATATAGTTGGG - Intronic
1103030774 12:117610577-117610599 GTCTCTACAAAAATTTAGCCTGG + Intronic
1105398582 13:20065821-20065843 GTGATTACAAAACTCTAGCATGG + Intronic
1105721432 13:23119374-23119396 AAGTATACGAAAATATAGGATGG - Intergenic
1105878046 13:24577205-24577227 GTGTATACAAAAAAATAAACGGG - Intergenic
1106639662 13:31570726-31570748 GTGTATATAACTATATAGAAGGG - Intergenic
1106810705 13:33356073-33356095 GTGTACATGAAAATATAGAAAGG - Intergenic
1109745684 13:66621018-66621040 ATGTATACGAAGATATATCAAGG + Intronic
1110023413 13:70505798-70505820 TTGTATTCAAAAAGATAGCACGG + Intergenic
1110052347 13:70920107-70920129 GTGTATACATACATATAAGATGG - Intergenic
1110465119 13:75791673-75791695 ATAAATACAAAAATAAAGCACGG + Intronic
1111589842 13:90330834-90330856 TTGTACAAAAAATTATAGCAAGG - Intergenic
1111589846 13:90330926-90330948 TTGTACAAAAAATTATAGCAAGG - Intergenic
1111720485 13:91937601-91937623 GTTTTTACAAAAATATAGTTGGG + Intronic
1111765667 13:92524972-92524994 GTGTATTGAAAAATAAAGAAAGG + Intronic
1112297492 13:98201095-98201117 ATGGGTACAAAAATACAGCAGGG - Intronic
1114396583 14:22368632-22368654 ATGTATACACATATATACCATGG + Intergenic
1115006824 14:28496192-28496214 GTCTCTACAAAAAAATAGCTTGG - Intergenic
1115708535 14:36024672-36024694 GTGGTTACAAAAATATAGCTAGG - Intergenic
1115972732 14:38963748-38963770 GTGTATAGAAAGAAACAGCAGGG - Intergenic
1116266362 14:42695640-42695662 ATGTATAGAAAAATATGCCAGGG + Intergenic
1118028464 14:61795459-61795481 ATGTATTAAAAAATAAAGCAAGG - Exonic
1118718579 14:68577676-68577698 CTATATAGAAAAATAAAGCAGGG - Intronic
1118935507 14:70284287-70284309 GTGTACACATAAATGTAGCCAGG - Intergenic
1119656793 14:76422876-76422898 GTGTAAACAAAAATGTTTCACGG - Intronic
1120264169 14:82228055-82228077 GTGTATAAATACATACAGCATGG - Intergenic
1125120419 15:36152015-36152037 ATGGATACAAAAAAATAGAATGG + Intergenic
1126929235 15:53629550-53629572 TTATATTAAAAAATATAGCAGGG + Intronic
1127890449 15:63246031-63246053 GAAAATACAAAAAAATAGCAGGG - Intronic
1129019287 15:72501383-72501405 GTATATACAAATATATAGTATGG + Intronic
1129103715 15:73290399-73290421 GTGTCTACAAAAAACTAGCCAGG - Intronic
1130147598 15:81286285-81286307 GAGAATACAGGAATATAGCAGGG + Intronic
1130231099 15:82097568-82097590 GTCTATACAAAAAATTAGCAGGG - Intergenic
1131813400 15:96197819-96197841 GTATATATAAAACTATGGCAAGG + Intergenic
1132145786 15:99428708-99428730 GTATATACACACATACAGCAAGG - Intergenic
1133549721 16:6842439-6842461 TTGTATATAAATATAGAGCAAGG - Intronic
1133647411 16:7777160-7777182 GTGTTTACAAAGATATAAGAAGG + Intergenic
1133719375 16:8480217-8480239 GTGAATACGAAAAAATAGAAAGG + Intergenic
1133724559 16:8525455-8525477 GAAAATACAAAAAAATAGCAGGG + Intergenic
1134544832 16:15099983-15100005 GAGGATACAAATATATAGTAAGG + Intronic
1135362461 16:21826700-21826722 GAGGATACAAATATATAGTAAGG + Intergenic
1135883798 16:26285386-26285408 GTGTAAACCACAAGATAGCAGGG + Intergenic
1137812605 16:51367202-51367224 GTGTATATACACATATAACAAGG + Intergenic
1138020543 16:53475990-53476012 GTATCTACAAAAAATTAGCAGGG - Intronic
1138398282 16:56724835-56724857 CTGTATATAAAAAAATAGAAAGG - Intronic
1140337939 16:74129120-74129142 ATGGATACAAAAATATAGTTAGG + Intergenic
1140542089 16:75765686-75765708 TAGTATAAAAAAATATATCATGG - Intergenic
1140678116 16:77353969-77353991 ATGCAAAGAAAAATATAGCATGG + Intronic
1141165540 16:81658381-81658403 GTGAATTCAAATACATAGCATGG - Intronic
1141578143 16:84978436-84978458 TTTTATAGAAAAATATAGCTGGG + Intronic
1142932195 17:3295747-3295769 ATGTAAACGAAAATAAAGCAGGG + Intergenic
1143705045 17:8691555-8691577 GTTTCTACAAAAAATTAGCAGGG - Intergenic
1144078561 17:11741328-11741350 GCATATACAATAATATAGAAAGG - Intronic
1149146131 17:53495579-53495601 GTGTATTAAAAAATGTAACAAGG + Intergenic
1151020154 17:70605943-70605965 GTGCAGACAGAAAAATAGCAGGG - Intergenic
1151206152 17:72509000-72509022 TTGTACACAACAATATATCATGG + Intergenic
1151281834 17:73081761-73081783 GTATATACATATATATATCATGG + Intronic
1151990161 17:77569690-77569712 GTCTATACAAAATTCAAGCAGGG + Intergenic
1154133329 18:11754713-11754735 TTGTATAAAAAATGATAGCATGG + Intronic
1154276233 18:12963110-12963132 TTATATACAAAAAGAAAGCATGG - Intronic
1155518048 18:26642423-26642445 GAGAATACAAAAGTTTAGCAGGG + Intronic
1156028157 18:32680857-32680879 GTGTATAAAACAAGATAACAAGG - Intronic
1156283174 18:35661881-35661903 TTTTATACTAAAATAGAGCATGG + Intronic
1156518812 18:37704182-37704204 GTGAACATAAAAATAGAGCAGGG + Intergenic
1156542519 18:37929067-37929089 GTGTATATATATATATACCATGG - Intergenic
1157530080 18:48412856-48412878 GTATATACAAAGAAACAGCAGGG - Intergenic
1157689159 18:49666829-49666851 TTGAACAGAAAAATATAGCAAGG + Intergenic
1158049315 18:53196714-53196736 GTGTATAAATATATATAGAACGG - Intronic
1158204286 18:54974356-54974378 ATGTATATGAAAATATAGAATGG + Intergenic
1158372783 18:56828726-56828748 GTGTGTTCAAAAACAGAGCACGG + Intronic
1158905804 18:62010624-62010646 ATGAATAAAAAAATATAGTATGG - Intergenic
1159529839 18:69641316-69641338 CTGTTTACAAAAATATTTCATGG + Intronic
1159614729 18:70568517-70568539 GTGTAGAGAAAAAAATAGTAAGG - Intergenic
1160278860 18:77467673-77467695 GTGTATTAAAAAATACACCATGG - Intergenic
1160785438 19:898242-898264 ATATATACAAAAAATTAGCAGGG + Intronic
1162160160 19:8706309-8706331 GTCTATACATATATATACCAAGG - Intergenic
1162916917 19:13879565-13879587 GTGTCTACAAAAAATTAGCTGGG + Intronic
1163168397 19:15513334-15513356 ATATATACAAAAAATTAGCAGGG - Intronic
1164078419 19:21841930-21841952 GTGTATATTGAAATATGGCAGGG + Intronic
1165010178 19:32840331-32840353 GTCTCTACAAAAAGATAGCTGGG - Intronic
1167728771 19:51237293-51237315 GTGTTTATAAAAATACAGAATGG - Intronic
1168684984 19:58343563-58343585 GTGTCTACAAAAAATTAGCCGGG + Intergenic
925021863 2:576117-576139 GTCTCTACAAAAAAATAGCCAGG - Intergenic
925038309 2:709150-709172 GTGTGTATAAAAATACAGCGTGG - Intergenic
925567123 2:5268528-5268550 CAGTATACAAATATGTAGCATGG - Intergenic
925590440 2:5503825-5503847 ATCTTTACAAAAATATAGAAAGG + Intergenic
925617921 2:5761683-5761705 ATGTATACAAAAAACTAGCCAGG - Intergenic
926160318 2:10483360-10483382 GTGTCAATAAAGATATAGCATGG - Intergenic
926387296 2:12349194-12349216 GTGCATACAAAATTACAGCGAGG + Intergenic
926540876 2:14179733-14179755 ATGTATACATAAACACAGCATGG - Intergenic
928870511 2:35972150-35972172 GAATATACTAAAATATAGTATGG + Intergenic
928966662 2:36982722-36982744 GTGAAGAAAAAAATACAGCAGGG - Intronic
929683871 2:44017797-44017819 GGGTATACAAAAAATTAGCCGGG + Intergenic
929742514 2:44618030-44618052 GTGTATACAAAGAAACAGGAAGG - Intronic
933231659 2:79814590-79814612 GTGTATACACACATATATAATGG - Intronic
933368206 2:81382343-81382365 GTGTATACAAAAATCCAGTTTGG - Intergenic
933524924 2:83425160-83425182 ATGTATATAAAAATATAACAAGG - Intergenic
934124412 2:88872780-88872802 GTCTTTTCAAAAATATTGCAAGG + Intergenic
934587154 2:95511640-95511662 TTGTTTAAAAAAGTATAGCAAGG - Intergenic
934954295 2:98604450-98604472 GTTTATATAAAAATCTAGAAAGG + Intronic
936408970 2:112236893-112236915 GTCTCTACAAAAACATAGCTGGG + Intronic
938075993 2:128337702-128337724 TTTTAGAAAAAAATATAGCAGGG + Intergenic
939528114 2:143321847-143321869 GTCTCCACAAAAATGTAGCAGGG - Intronic
941005783 2:160245538-160245560 GTTAAGAGAAAAATATAGCAAGG - Intronic
941356125 2:164494605-164494627 GTGTATGCATAAATGTAGCTGGG + Intronic
942405824 2:175653784-175653806 GTGTATATATATATATACCATGG + Intergenic
943560347 2:189454093-189454115 GTCTAGAGAAAAATAAAGCAGGG + Intronic
945561740 2:211348108-211348130 GTGTACACAACACTATAACATGG + Intergenic
947047393 2:226003729-226003751 ATCTATATAAAATTATAGCATGG + Intergenic
1169678023 20:8177000-8177022 GTTTATAGAAAAATATCTCATGG + Intronic
1170158874 20:13292890-13292912 GTGTATAAAAAATTTTTGCAGGG - Intronic
1172411922 20:34730873-34730895 GTCTATACAAAAAATTAGCTGGG - Intronic
1172457715 20:35091156-35091178 GTGTCTCCAAAAATTTAGCCGGG - Intronic
1173749532 20:45466440-45466462 GTGTAAAAAAATATATATCAGGG - Intergenic
1174234937 20:49081900-49081922 ATGTATACATAAATATGGCCTGG - Intronic
1176964121 21:15192943-15192965 GTCTCTACAAAAAACTAGCAGGG - Intergenic
1177051173 21:16236059-16236081 AACTATACAAAAATATAACAAGG - Intergenic
1177429836 21:20977675-20977697 GAGAATACAAAATTATAGCTAGG - Intergenic
1178385211 21:32143529-32143551 TTGGAAACAAAAATATAGCATGG - Intergenic
1178774053 21:35532187-35532209 GTCTCTACAAAAATTTAGCCGGG + Intronic
1179328451 21:40374559-40374581 GGGTATACAAAAATACTCCATGG - Intronic
1183369860 22:37426447-37426469 GTGTATACAGACAGAGAGCAGGG + Intronic
951561918 3:23976021-23976043 GAGTATACAAAAATATTCAATGG - Intronic
952579965 3:34822142-34822164 CTGAATACAAAAATACATCATGG - Intergenic
953252376 3:41257947-41257969 TAGTATACAATAATTTAGCAAGG - Intronic
953672935 3:44977665-44977687 GTGTATACAAAAATATAGCAGGG - Intronic
955184542 3:56702424-56702446 GAAAATACAAAAATATAGCCAGG + Intergenic
955641617 3:61091777-61091799 GTCTCTACAAAAATTTAGCTGGG + Intronic
956325535 3:68048555-68048577 ATGTGTACAAAAATATGGAAAGG - Intronic
956762447 3:72455914-72455936 GTGTAAAGAAAGATAAAGCAGGG - Intergenic
958566807 3:95822221-95822243 ATGTAAACTTAAATATAGCATGG - Intergenic
958593650 3:96192766-96192788 ATGTAAAGAAAACTATAGCAGGG + Intergenic
961223264 3:125216905-125216927 TTGTATAGAAAAATATGGCCGGG + Intergenic
962639769 3:137373269-137373291 GTGTATTCAAATAGAAAGCATGG - Intergenic
964060181 3:152512625-152512647 GTGTATATATATATATAGTAGGG - Intergenic
964749760 3:160043442-160043464 GTGTAAACAAACCTATTGCATGG + Intergenic
964765060 3:160171580-160171602 CTGTAGATAAAAATATTGCAGGG - Intergenic
966422917 3:179751610-179751632 ATGTATACTAAACTCTAGCAAGG + Intronic
967801033 3:193660104-193660126 GTGAATAGAAAAAAATAGTAAGG + Intronic
970595618 4:17597435-17597457 GTGTCTACAAAAAGCTAGCCAGG - Intronic
970833376 4:20369735-20369757 CTGTATATAAAAAGGTAGCAGGG + Intronic
970950911 4:21754285-21754307 CTGTATAGACAAATAAAGCAAGG - Intronic
971649100 4:29248910-29248932 GTGTATACAAAAACCAAGCAAGG - Intergenic
971949045 4:33319253-33319275 ATGTATACATGAATATATCATGG - Intergenic
972411490 4:38799993-38800015 CTGTAGAGAAAAATAAAGCAGGG + Intronic
972624060 4:40778897-40778919 GTGGATATAAAAATCTAGCCTGG - Intronic
974175243 4:58314285-58314307 GTGTATACATGAATGTGGCAAGG + Intergenic
974559590 4:63499555-63499577 ATGGATACAAAAATATAGTCAGG + Intergenic
977967843 4:103175602-103175624 ATGTATAGAATAATATATCAGGG - Intronic
978312031 4:107395292-107395314 GTATATATAAATATATAGCAGGG - Intergenic
978992260 4:115098858-115098880 GTATATAAAAAAAATTAGCAAGG - Intronic
979313713 4:119234526-119234548 GTGTATATAAAAATAGTTCATGG + Intronic
980027016 4:127780097-127780119 GTGTATAGAACAATATGGCCTGG - Intergenic
980210139 4:129776622-129776644 GTGTATACAAATACATAATAGGG + Intergenic
980392140 4:132160482-132160504 GTGTATACATATATATTGAATGG + Intergenic
980402706 4:132313544-132313566 ATGTATACACATATATAGGATGG + Intergenic
980555919 4:134404600-134404622 ATGTATATAAAAATATAGCTGGG - Intergenic
980637121 4:135520939-135520961 GTATATACAAAAATAACACAGGG + Intergenic
980843230 4:138292018-138292040 GCACATACAAAAATATATCATGG + Intergenic
981731827 4:147907630-147907652 GTGTATAGGAAAAGAGAGCAAGG + Intronic
983184587 4:164687507-164687529 GTGTATGAGAAAATATAGGATGG - Intergenic
983691649 4:170476759-170476781 GTGTAAAGAAAATTGTAGCATGG - Intergenic
983799759 4:171912620-171912642 TAGTATTCAATAATATAGCAGGG - Intronic
984760514 4:183359069-183359091 GTGTGTACAGAAATACAGAAGGG + Intergenic
984779041 4:183506632-183506654 GTGTCTACAAAAACAGAGAATGG - Intronic
986083516 5:4418935-4418957 CTCTATAAAAAAATATAGCTGGG + Intergenic
986995060 5:13597503-13597525 ATGTATATATATATATAGCAAGG - Intergenic
987779220 5:22411098-22411120 GTATATACAAAGATATATAATGG + Intronic
988448320 5:31312528-31312550 GTCTCTACAAAAAATTAGCAGGG + Intronic
992314696 5:75540465-75540487 GTCTACACAAAAAAATAGCCAGG - Intronic
993165598 5:84350670-84350692 CTGCATACAAAAATATTCCATGG + Intronic
993719084 5:91304321-91304343 GTGTATACAGAAAGTTAGCTTGG - Intergenic
994003387 5:94807911-94807933 GTGTATACAGAAAAAAAGCTAGG + Intronic
994116753 5:96069981-96070003 GTCTCTACAAAAATAAACCAGGG + Intergenic
994177279 5:96724660-96724682 GTGTCTACAAAAAATTAGCCAGG + Intronic
995143742 5:108763248-108763270 ATGTATATAAAAGTATGGCAAGG - Intronic
995658850 5:114458554-114458576 ATGCTTACAAAAACATAGCAGGG - Intronic
995816528 5:116175530-116175552 GTATATTCAAAAGAATAGCAAGG + Intronic
996035044 5:118749541-118749563 GAGTATGCAAAAATCTAGCCAGG - Intergenic
996336776 5:122392357-122392379 ACGTAGACAAAAATATATCATGG - Intronic
996922844 5:128789020-128789042 GTGTATACAAAATTATTGTTGGG + Intronic
997490330 5:134270402-134270424 GTAAATACAAAAAATTAGCAGGG - Intergenic
997652279 5:135531302-135531324 GTGTATACAAATATATATGTTGG + Intergenic
998812514 5:145980295-145980317 GTGTACACAAAGATAAAGCCTGG - Intronic
998988187 5:147785309-147785331 GTATATAGAAAAATAGAACATGG - Intergenic
999337012 5:150729273-150729295 ACGTGTACAAAAATATAGAATGG + Intronic
999900739 5:156084120-156084142 GTGTCTACAAAAATTTTGCTTGG + Intronic
1000137160 5:158364001-158364023 TCGTATACACATATATAGCATGG + Intergenic
1001456176 5:171861980-171862002 GTGCCTACTAAATTATAGCAGGG - Exonic
1002693430 5:181067113-181067135 ATGGATACACAAAGATAGCAGGG + Intergenic
1002848938 6:974167-974189 GTGTATATATATATATACCATGG + Intergenic
1003035620 6:2638364-2638386 GTGTAGACAGAAAAAGAGCAAGG - Intergenic
1003354158 6:5350307-5350329 GTGTATAAAAAAATCTTGCTGGG - Intronic
1004420050 6:15461185-15461207 GTGCAGACAACAATATAGGAAGG + Intronic
1004786896 6:18978201-18978223 GTGTAAAAATAAATAAAGCATGG + Intergenic
1006095613 6:31654518-31654540 GTGTCTACAAAAAATTAGCTAGG + Intronic
1006098582 6:31671505-31671527 GTCTCTACAAAAAAATAGCCAGG + Intronic
1006391118 6:33759400-33759422 GTGTATACAAAAAATTAGCCAGG - Intergenic
1006972738 6:38063489-38063511 GTGTATGCAAACATGTATCAGGG - Intronic
1007031196 6:38628701-38628723 AGATATACAAAAATATAGAAAGG + Intronic
1007045591 6:38770963-38770985 GTGTATACAAAAACATTGTGCGG + Intronic
1007201245 6:40111186-40111208 GTTTATACAAAAATATACCAAGG - Intergenic
1009603146 6:65829721-65829743 GGATATAGGAAAATATAGCAGGG - Intergenic
1009658844 6:66583003-66583025 ATGGATACAAAAATATAGTTAGG - Intergenic
1010417888 6:75635529-75635551 GTAAACAGAAAAATATAGCAAGG - Intronic
1010790536 6:80059240-80059262 GTATACATAAAAATACAGCAAGG - Intergenic
1011035763 6:82972671-82972693 ATGTACATAAAAATATAGCTTGG + Intronic
1011208231 6:84924575-84924597 GTCTTTACAAAAAAATAGCGAGG - Intergenic
1012166480 6:95960002-95960024 GGGTATATAAAAAAATTGCAGGG - Intergenic
1012176948 6:96098889-96098911 GTGTATACAACAGTATCTCAGGG - Intronic
1012229071 6:96739151-96739173 GTGTATTAAAAAACAGAGCAAGG + Intergenic
1012440475 6:99257588-99257610 GTGTCTACAAAAATTTAGCCAGG - Intergenic
1012694988 6:102368974-102368996 GTTTATAAAAAATTATATCATGG - Intergenic
1012997813 6:105991290-105991312 CTGTATATAAAAATAAAGCATGG + Intergenic
1013093196 6:106920108-106920130 ATGTATACAAAAAAAGAGTATGG + Intergenic
1013471165 6:110467645-110467667 GTGTATCCAAAAATTTAGCCTGG + Intronic
1014358985 6:120451778-120451800 GTGTTTACAGAGATGTAGCAAGG + Intergenic
1015584827 6:134764787-134764809 GTGTATCTCAAAATATAGAAGGG + Intergenic
1015601337 6:134913932-134913954 GTGTATATATACATATACCATGG - Intergenic
1016203513 6:141443116-141443138 ATGAAAATAAAAATATAGCAAGG + Intergenic
1016473528 6:144401183-144401205 ATGAATAAAAAAATATAGAAAGG - Intronic
1017302299 6:152875910-152875932 GTGAATACAAAAAATTAGCCGGG + Intergenic
1018090086 6:160338701-160338723 ATGAATACAACAATACAGCATGG - Intergenic
1020216531 7:6195613-6195635 GTGAATACAAAAAATTAGCCGGG - Intronic
1020847550 7:13306423-13306445 GAAAATACAAAAATATAGCTGGG + Intergenic
1020973180 7:14972894-14972916 GTGTATACATACATATAGGTGGG + Intronic
1024610249 7:51058185-51058207 GTGCATACATAAACATAGAAGGG - Intronic
1025099130 7:56121131-56121153 ATGTATACAAAAAATTAGCCAGG + Intergenic
1025191976 7:56902684-56902706 GTGTCCATAAAAATATAGCTTGG + Intergenic
1025592529 7:62880275-62880297 GAATCTACAAAAATATAGCAGGG + Intergenic
1025679976 7:63674247-63674269 GTGTCCATAAAAATATAGCTTGG - Intergenic
1026386260 7:69851365-69851387 GTATTTACAAAAATTTTGCAGGG + Intronic
1027253773 7:76416636-76416658 GTCTCTACAAAAAAATAGCTGGG + Intronic
1027806255 7:82828327-82828349 GTATGTACAAAACTATAGTAAGG - Intronic
1029158342 7:98533259-98533281 GTATATACAAAAAATTAGCATGG + Intergenic
1030249257 7:107424110-107424132 TTGAATACAAAAAATTAGCAGGG + Intronic
1031036873 7:116796917-116796939 GTCTATACAAAAATTTATAAGGG - Intronic
1031501507 7:122523740-122523762 GTGTAGACAAAAATTTTGAAGGG - Intronic
1031569531 7:123341894-123341916 GTGGATACAAAAATTAGGCAAGG + Intergenic
1032740394 7:134732776-134732798 TTAGATATAAAAATATAGCATGG - Intergenic
1032917010 7:136502501-136502523 ATGTATACAAAAAGAAAGAATGG + Intergenic
1033305324 7:140221188-140221210 ATGTAAGCAAAAATATAGTATGG + Intergenic
1033352267 7:140571108-140571130 CAGTAAACAAAAATATAGGATGG + Intronic
1033647130 7:143314170-143314192 GTGTATATAAATATATATAATGG - Intergenic
1034351683 7:150419761-150419783 ATGTATTTAAAAGTATAGCATGG + Intergenic
1034366526 7:150554093-150554115 ATGAAAACAAAGATATAGCATGG + Intergenic
1036103896 8:5818965-5818987 GTGCATACAAAACATTAGCATGG - Intergenic
1036431337 8:8694127-8694149 GTGTATACAAAAATACTAGAAGG - Intergenic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1038923988 8:32117439-32117461 TTGGATAGAAAAATATATCAAGG + Intronic
1039212374 8:35232453-35232475 GGGTATTCAAAATTATAACATGG + Intergenic
1039388154 8:37154684-37154706 GAATATACAAAGGTATAGCAAGG - Intergenic
1039603390 8:38861079-38861101 GTCTATACAAATATATTGTATGG - Intergenic
1041339275 8:56824684-56824706 ATGCATACAAAAATTTAGAATGG + Intergenic
1041475463 8:58260404-58260426 GTGGATGCAAGAATATGGCAGGG - Intergenic
1042316186 8:67428642-67428664 AAGAATACAAAAAAATAGCAAGG - Intronic
1042735468 8:71983087-71983109 GTGTATATATATATATAGCTAGG + Intronic
1044769296 8:95613006-95613028 TTGTATATGAAAATAAAGCAGGG + Intergenic
1045595732 8:103652920-103652942 ATTTATACTAAAATATAGCAGGG - Intronic
1045622658 8:103999936-103999958 GTTTATATTAAAATATAACATGG + Intronic
1046270630 8:111892236-111892258 GTGTACACACAAATATACTATGG + Intergenic
1046793709 8:118348235-118348257 GTCTCTACAAAAATTTAGCCAGG - Intronic
1047420030 8:124699976-124699998 GTGTCTACAAAAAATTAGCCAGG + Intronic
1047501432 8:125444870-125444892 GTCTATACAAAAAATTAGCCTGG - Intergenic
1048787520 8:138066088-138066110 GTGTATATATATATATATCAAGG - Intergenic
1049144474 8:140988566-140988588 GAAAATACAAAAAAATAGCAGGG + Intronic
1051112553 9:13655887-13655909 ATGTATACCAATATATAGTAAGG + Intergenic
1051424388 9:16918892-16918914 GTGTCTACAAAAAATTAGCTGGG + Intergenic
1051856361 9:21571314-21571336 TTGAATATAAAAATATACCATGG + Intergenic
1052610547 9:30767962-30767984 GTGAGTCCAAAAATATAGCATGG - Intergenic
1054937900 9:70708938-70708960 GTCCATAAAAAAATATACCATGG - Intronic
1054939591 9:70726931-70726953 GTCCATAAAAAAATATACCATGG - Intronic
1055303292 9:74904076-74904098 CTGTATACAAAAAATTAGCCAGG - Intergenic
1056927231 9:90845234-90845256 GTGTATAAATAAAAATAACATGG - Intronic
1057133657 9:92671653-92671675 GTCTCTACAAAAAATTAGCAGGG + Intergenic
1057579227 9:96271259-96271281 GTTTATTTAATAATATAGCATGG - Intronic
1058264302 9:102878407-102878429 GTACATTTAAAAATATAGCAAGG - Intergenic
1058603551 9:106696935-106696957 GTGTAGAAAGTAATATAGCAGGG - Intergenic
1059377322 9:113894075-113894097 TTGTATAAAAAAATAATGCAAGG - Intronic
1059757302 9:117305422-117305444 ATGTATTTAAAAAAATAGCAGGG - Intronic
1059877455 9:118650966-118650988 GAGTATACACAAATATAGAATGG - Intergenic
1060013315 9:120063811-120063833 TTGTTAACAAAAATAAAGCAGGG - Intergenic
1061956466 9:133964305-133964327 GTGTATATATATATATATCAGGG - Intronic
1186283248 X:8017306-8017328 GTGAATACAACAGTGTAGCAGGG - Intergenic
1186722331 X:12318657-12318679 GTGGATACAAAAATACAGTTAGG + Intronic
1186884494 X:13899518-13899540 ATGGATACAAAAATGTAGCCTGG + Intronic
1187545580 X:20248641-20248663 GTTTATACAAAAAATTAGCTGGG - Intronic
1187555879 X:20350691-20350713 CAGTATATGAAAATATAGCATGG + Intergenic
1187813686 X:23208249-23208271 GTGTATGCATAATTGTAGCAAGG + Intergenic
1187908125 X:24086282-24086304 ATATATACAAAAAAATAGCCGGG - Intergenic
1188533873 X:31173281-31173303 CAGTATAAAAAAACATAGCAAGG + Intronic
1188644599 X:32550180-32550202 GTGTATCCAAACATATCGAAAGG + Intronic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1189278128 X:39802106-39802128 GTGCATACAATAAAATACCATGG + Intergenic
1189591578 X:42517986-42518008 GTGTGTAAAAAAATAGAGAAGGG - Intergenic
1190191160 X:48278341-48278363 GTGTCTACAAAAAATTAGCTGGG + Intergenic
1191840027 X:65506327-65506349 ATGAATACATAAATACAGCATGG + Exonic
1191932629 X:66390933-66390955 GTTCATAATAAAATATAGCATGG - Intergenic
1192013580 X:67302642-67302664 GTGCAAACCAAAAGATAGCAGGG + Intergenic
1192159806 X:68776008-68776030 GTCTTTACAAAAAATTAGCAGGG + Intergenic
1192470782 X:71396862-71396884 GTCTCTACAAAAATTTAGCTGGG + Intronic
1193814575 X:86089664-86089686 GTGTATATATATATATAGTATGG - Intergenic
1194100982 X:89703624-89703646 GTCATTACAAAATTATAGCAGGG - Intergenic
1195785831 X:108521681-108521703 GTGTCTATAAAACTATGGCAAGG + Intronic
1196150353 X:112366671-112366693 GTGGATACAAAAAAATAGGGGGG - Intergenic
1196948615 X:120853401-120853423 ATGTATACAAAAAGATTGGAAGG + Intergenic
1197254448 X:124247633-124247655 GTGTCTACAAAAAATTAGCCAGG - Intronic
1198342764 X:135731387-135731409 GTGGGTACAAAAATATAGTTAGG - Intergenic
1198345225 X:135751908-135751930 GTGGGTACAAAAATATAGTTAGG + Intergenic
1198468735 X:136926631-136926653 ATGCATACAAAAAGAAAGCAAGG - Intergenic
1198599843 X:138270597-138270619 GTGCATAAAAAAATTAAGCATGG - Intergenic
1200453936 Y:3364709-3364731 GTCATTACAAAATTATAGCAGGG - Intergenic
1201339415 Y:12917380-12917402 CTGTAAGCAAAAATATGGCATGG - Intronic
1201373404 Y:13289902-13289924 GGCAATACAAAAATATAGTAGGG + Intronic
1201428102 Y:13876045-13876067 GTTTATACATATATGTAGCATGG - Intergenic
1201454175 Y:14150472-14150494 ATGTATACACAAATATTTCATGG + Intergenic
1201854307 Y:18524187-18524209 GTCTCTACAAAAATGTAGCCGGG + Intergenic
1201879014 Y:18796198-18796220 GTCTCTACAAAAATGTAGCCGGG - Intronic