ID: 953674559

View in Genome Browser
Species Human (GRCh38)
Location 3:44990689-44990711
Sequence CCAAGATTTTTACTGGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 1, 2: 13, 3: 52, 4: 211}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953674554_953674559 -5 Left 953674554 3:44990671-44990693 CCATTAGAGACTCAGCACCCAAG 0: 3
1: 2
2: 10
3: 24
4: 124
Right 953674559 3:44990689-44990711 CCAAGATTTTTACTGGGAGCTGG 0: 1
1: 1
2: 13
3: 52
4: 211
953674551_953674559 6 Left 953674551 3:44990660-44990682 CCCAGGAAAGCCCATTAGAGACT 0: 2
1: 2
2: 19
3: 37
4: 352
Right 953674559 3:44990689-44990711 CCAAGATTTTTACTGGGAGCTGG 0: 1
1: 1
2: 13
3: 52
4: 211
953674552_953674559 5 Left 953674552 3:44990661-44990683 CCAGGAAAGCCCATTAGAGACTC 0: 1
1: 4
2: 53
3: 86
4: 240
Right 953674559 3:44990689-44990711 CCAAGATTTTTACTGGGAGCTGG 0: 1
1: 1
2: 13
3: 52
4: 211
953674553_953674559 -4 Left 953674553 3:44990670-44990692 CCCATTAGAGACTCAGCACCCAA 0: 4
1: 3
2: 10
3: 25
4: 130
Right 953674559 3:44990689-44990711 CCAAGATTTTTACTGGGAGCTGG 0: 1
1: 1
2: 13
3: 52
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953674559 Original CRISPR CCAAGATTTTTACTGGGAGC TGG Intronic
900561288 1:3308355-3308377 CCAAGATTCTTTCTGGGATGTGG - Intronic
905128656 1:35734779-35734801 GCCAGTTTTTTACTGGGAGATGG - Intronic
905615189 1:39392145-39392167 CAAAGATTTTTGCTGGGAGAAGG - Intronic
911662974 1:100524112-100524134 CCTAGGTTTCTACTGGGGGCTGG + Intergenic
911993530 1:104733684-104733706 CCAAGATTTATACTGGTATTTGG + Intergenic
913239003 1:116811707-116811729 TCAAGATTTTTACTGGAGGCTGG - Intergenic
913269702 1:117080921-117080943 CCAAGGTTTTTATTGGGGGCTGG + Intronic
919011916 1:191975683-191975705 CCAGGATTTTTACTGGGAACTGG - Intergenic
921030882 1:211334275-211334297 CCAAGGTTTTTACTAAGGGCTGG + Intronic
921155413 1:212434464-212434486 CCAAGGTTTTCACTGGGGGCTGG - Intronic
923435460 1:233963895-233963917 CCTAGTTTTTTTCTGGGATCAGG + Intronic
924572615 1:245251120-245251142 CCAAGGTTTTTGTTGGGGGCTGG + Intronic
1063334449 10:5198504-5198526 CCAAGATTTTAACTGGGTGCTGG - Intronic
1063472084 10:6296174-6296196 CCAAGTTCTTTACTGGAAGTTGG + Intergenic
1063649490 10:7918837-7918859 CCAAGATGTTTACTGCAAGGAGG + Intronic
1064673636 10:17740250-17740272 CCATGGTTTTTACGGGGCGCTGG - Intergenic
1065138010 10:22691701-22691723 TCAAGTTTTGTGCTGGGAGCAGG - Intronic
1065339834 10:24694504-24694526 ACAAGATGTTTACTGGGGGCAGG - Intronic
1065513577 10:26503850-26503872 ACATGAATTTTCCTGGGAGCTGG + Intronic
1067656599 10:48197035-48197057 CCAGGATATTTCCAGGGAGCTGG - Intronic
1068685775 10:59868754-59868776 CGAGGGTTTTTACTGGGGGCTGG - Intronic
1068724924 10:60290187-60290209 CCAAGGTTTTTACTGACAGACGG - Intronic
1069608751 10:69758073-69758095 CCAAGATATTTCCTGGCATCTGG - Intergenic
1071155299 10:82681486-82681508 CCAATATTTTTGCTGAAAGCTGG + Intronic
1071688715 10:87792305-87792327 CCAACATATTTATTGGGGGCTGG - Intronic
1072080269 10:92023035-92023057 CCAAAGTTTTTACTGGGGGCTGG + Intronic
1072748641 10:97959960-97959982 CCAGGGTTTTTACTTGGGGCTGG + Intronic
1072778650 10:98227346-98227368 TCAAGAGTTTTATTGGGAGAAGG - Intronic
1073670632 10:105583699-105583721 CCAAGGTTTTTATTGGAGGCTGG + Intergenic
1073748711 10:106499551-106499573 CCTAGATTTTTCCTTGGAGCAGG - Intergenic
1074101630 10:110358640-110358662 TCAAAATTTTTACAGGAAGCTGG + Intergenic
1074329487 10:112490819-112490841 ACAAAATTTTTGCTGGCAGCCGG + Intronic
1074484963 10:113867021-113867043 CCAAGGCTTTTATTGGGGGCTGG + Intronic
1080069352 11:28060820-28060842 CCCAGGTTTTTATTGGGAGCTGG - Intronic
1083113167 11:60431952-60431974 CCAAGATTTTTCTTGGAAGTGGG - Intronic
1086951950 11:92899497-92899519 TCAGGGTTTTTACTGGGGGCTGG + Intergenic
1088264184 11:107974072-107974094 CCAGGGTTTTTACTGAGGGCTGG + Intergenic
1088530308 11:110800967-110800989 CGAAGATTTTAACAGGGAGTTGG + Intergenic
1089026036 11:115270718-115270740 CCAACGTTTTTATTGGGAGTGGG - Intronic
1090808575 11:130218024-130218046 CAAGGATTTTCACTGGGACCTGG + Intergenic
1091306455 11:134539304-134539326 CCAAGATCTTTTCAAGGAGCTGG - Intergenic
1091681109 12:2527699-2527721 CCAAGCTTTTTACTCAAAGCTGG - Intronic
1093697038 12:22172438-22172460 CCCAGAATTTACCTGGGAGCTGG + Intronic
1096616543 12:52836299-52836321 CCACGCTTTGTGCTGGGAGCTGG + Intergenic
1097817007 12:64085867-64085889 CCAACATTTTTACTGTGGCCTGG + Intronic
1097823340 12:64149645-64149667 CTAAGATTCTTACAGGGTGCAGG - Exonic
1098342064 12:69462417-69462439 CAAAGAAATTCACTGGGAGCCGG - Intergenic
1099532995 12:83809871-83809893 CCAAAATTTTAACTAAGAGCTGG - Intergenic
1101071147 12:101077146-101077168 CCAGGGTTTTTATTGGGGGCTGG - Intronic
1102176889 12:110882615-110882637 CCCAAATTCTTACTGGGGGCTGG + Intronic
1103211366 12:119169253-119169275 TCAAGCTTTGTTCTGGGAGCAGG - Intergenic
1103989771 12:124791051-124791073 CCAGGGTTTTTACTAGGGGCTGG - Intronic
1104024283 12:125014593-125014615 CCAGGCTTTTTACTGGGGGCTGG + Intronic
1104207234 12:126650936-126650958 CCAGGAGTTTTACTGTGGGCTGG + Intergenic
1105051087 12:133051682-133051704 CCAAGGTCTTTACTGGGAGCTGG + Intronic
1106052937 13:26208334-26208356 CCCAAAATTTTACTGGGGGCTGG - Intronic
1107258161 13:38455672-38455694 GTAGGTTTTTTACTGGGAGCTGG + Intergenic
1108613130 13:52103747-52103769 CCAGGATTTTTACTGGGGACTGG - Intronic
1109150618 13:58843355-58843377 CCAAGTTTATTTCTGGCAGCTGG - Intergenic
1111651603 13:91097409-91097431 CCAGGGTTTTTACTGGGGACTGG - Intergenic
1112069766 13:95836617-95836639 CCAGGGGTTTTACTGGGGGCTGG - Intronic
1113515759 13:110896513-110896535 GCAAGATTTTTAATGTGAGCAGG - Intronic
1115435494 14:33367999-33368021 GCAACATTTATCCTGGGAGCAGG - Intronic
1116487429 14:45467393-45467415 CCCAAGGTTTTACTGGGAGCTGG - Intergenic
1116622940 14:47228892-47228914 CCAAGATTTTTGCTGGGGGCTGG + Intronic
1121515468 14:94546944-94546966 CCAAGTTTTTTGGTGGGATCTGG - Intergenic
1121620900 14:95347683-95347705 CCAAGATTTCTTCAAGGAGCAGG + Intergenic
1121709636 14:96027920-96027942 CCAACACCTTTACTGGGAGCTGG - Intergenic
1122875839 14:104664471-104664493 CGGAGATTTCTACTGGGATCTGG + Intergenic
1123427512 15:20184202-20184224 CCAAGGTTTTTCCTTGGAGGAGG + Intergenic
1123536748 15:21190752-21190774 CCAAGGTTTTTCCTTGGAGGAGG + Intergenic
1124370064 15:29099477-29099499 CCAAGGTGTTTACTGGGAGTTGG + Intronic
1125814059 15:42568689-42568711 CCAGGGTTTTTACTGGGGGCTGG - Exonic
1127006716 15:54579020-54579042 CCTGGATTTTTACTGGAGGCTGG - Intronic
1127939608 15:63681734-63681756 CCAAGGTTTTTACTGGGGGCTGG - Intronic
1128624963 15:69191593-69191615 CCAAGGGTTTTATTGGGAGCTGG + Intronic
1129066666 15:72910726-72910748 CCAAGAATTTTACTGGTAATAGG - Intergenic
1129274145 15:74434218-74434240 CCAATCTTTTTACGGGGTGCGGG - Exonic
1131494685 15:92896501-92896523 GGAAGATTTTTACTGAGATCAGG + Intronic
1131769188 15:95716449-95716471 ACAAGATTATTAATGGGAGCAGG + Intergenic
1131800490 15:96064291-96064313 CCAGAGTTTTTACTGGGAGTTGG + Intergenic
1132250693 15:100333531-100333553 CCTAGCTTTTCACTGGGTGCTGG + Intronic
1132325647 15:100967529-100967551 GCAGGATTTTTCCTGGGAGCAGG + Intronic
1135869469 16:26136209-26136231 TCAAGATTTTCAGTGGGAACAGG + Exonic
1136486986 16:30579680-30579702 CCAAGATAATTAATGGGAACTGG - Intronic
1136856782 16:33665607-33665629 CCAAGGTTTTTCCTTGGAGGAGG - Intergenic
1137043736 16:35637944-35637966 CCAAGCTTTATACTGAGAGCTGG + Intergenic
1137506798 16:49061110-49061132 CCAAGATTTTTTCTGGGGTGTGG + Intergenic
1138868822 16:60855607-60855629 CCAAGATGTTTAAAGGAAGCTGG - Intergenic
1141180055 16:81746340-81746362 CCCAGATGTTTTCTGGGAGTTGG - Intronic
1203118356 16_KI270728v1_random:1514082-1514104 CCAAGGTTTTTCCTTGGAGGAGG - Intergenic
1143293774 17:5855264-5855286 CAAGGGTTTTTATTGGGAGCAGG + Intronic
1144102623 17:11955829-11955851 CCAAGGATTTTATTAGGAGCTGG + Intronic
1145095149 17:20018864-20018886 CCAGGGTTTTTATTGGGGGCTGG + Intronic
1146138028 17:30340353-30340375 ACAAGATATTTCCTTGGAGCAGG + Intergenic
1149600186 17:57888505-57888527 CCAAGAGTTTTGCTGTGAGAAGG + Intronic
1150431054 17:65117708-65117730 CCAAAGTTTTTACTGAGGGCTGG - Intergenic
1150557086 17:66264057-66264079 CCAGGATTTTTGGTGGGAGAGGG - Intergenic
1151448597 17:74183087-74183109 TCAAGACTTTTTCTGGGAGGAGG - Intergenic
1151548661 17:74808706-74808728 CCAAGCTTCTAGCTGGGAGCTGG - Intronic
1151872418 17:76845268-76845290 CCAAGGTTTTTACTGAGGGCTGG + Intergenic
1152487510 17:80603810-80603832 CCAGGGTTTTTACTGGAGGCTGG + Intronic
1153483755 18:5574659-5574681 CCAGGACTTTTACAGGGAGCAGG - Intronic
1153510212 18:5843816-5843838 CCAAGGTTTTTATGGGGAGCTGG - Intergenic
1154259583 18:12818749-12818771 TGAAAATTTTTATTGGGAGCAGG - Intronic
1157186405 18:45543933-45543955 CCAGCATTTTTACTTGGGGCTGG - Intronic
1157767566 18:50312002-50312024 CTAAGGCTTTTACTGGGAGCTGG + Intergenic
1158587987 18:58757487-58757509 CCAAGGTTTCTACTAGGGGCTGG + Intergenic
1158651956 18:59296267-59296289 TCAAGGTGTCTACTGGGAGCCGG - Exonic
1162500012 19:11047715-11047737 CCAGCATTTTTACTGGGACTTGG + Intronic
1162959994 19:14119937-14119959 CTAAGAATCTTCCTGGGAGCAGG + Exonic
1163366114 19:16876955-16876977 CAAAAATTGTGACTGGGAGCTGG - Intronic
1163730247 19:18944903-18944925 CCAAGACCTTCACTGGGAGGTGG - Intergenic
1167534385 19:50040354-50040376 CCAGGGTTTTTACTGGGGGCTGG + Intronic
925016130 2:525663-525685 CCAAGACTTCCACAGGGAGCTGG + Intergenic
925948195 2:8886126-8886148 CCAAAGTTTTTACTGGGGGCTGG - Intronic
926066574 2:9844734-9844756 CCAGGCTTTTTACTAGGTGCTGG - Intronic
928016260 2:27660739-27660761 CCAAGCACTTTACTAGGAGCAGG - Intronic
928501783 2:31904408-31904430 CCAGGATTTTTATTGGGGACTGG - Intronic
930128121 2:47819761-47819783 CCAAAATTTTTACTTTTAGCAGG + Intronic
933888169 2:86739716-86739738 CCAGGGTTTTTATTGGGGGCTGG - Intronic
933922009 2:87056990-87057012 CCAGGGTTTTTATTGGGGGCTGG + Intergenic
934589104 2:95530397-95530419 CCAAGGTTCCTCCTGGGAGCAGG + Intergenic
934668030 2:96187647-96187669 CCAAAATTTTTATTGGGAGCTGG - Intronic
936262382 2:110972856-110972878 CCATGGTTTTTATTGGGGGCTGG + Intronic
936280097 2:111131413-111131435 CCAATATTTTTAATGGATGCAGG + Intronic
938070761 2:128307007-128307029 CCCAGATTTTCACTGGGAGTTGG + Intronic
940903663 2:159149201-159149223 CTGGGATTTTTACTGGGAGAAGG + Exonic
940927429 2:159380733-159380755 TCCAGGTTTTTACTGGGGGCTGG - Intronic
942410727 2:175706912-175706934 CCAAGGATTTGACTGGGGGCTGG - Intergenic
942626803 2:177909932-177909954 CCAAGATTTTGATTGGCAGCTGG - Intronic
944639896 2:201714328-201714350 CCAGGGTTTATACTGGGGGCGGG - Intronic
944796857 2:203195797-203195819 CCAAGGTTTTTATTGGAGGCTGG + Intronic
945186174 2:207141995-207142017 ACAAGATTCTTATTGAGAGCAGG - Intronic
945807090 2:214502849-214502871 GGAAGCTTTTTACTGGAAGCAGG - Intronic
948418740 2:237838907-237838929 CCAAGGATTTTACTGGGGGATGG + Intronic
948647916 2:239420271-239420293 CCAAGGTTCCTTCTGGGAGCAGG - Intergenic
948735134 2:239998691-239998713 CCGTAATTTTTACTGGGGGCTGG - Intronic
1169707831 20:8526381-8526403 CCTAGCTTTTAACTGGGACCTGG + Intronic
1170435533 20:16324211-16324233 AACAGATTTTTACAGGGAGCAGG + Intronic
1171014761 20:21530204-21530226 CCAAGGTTTTTACTTGGAAAAGG + Intergenic
1173767050 20:45621652-45621674 CCAAGGTTTCTATTGGGGGCTGG - Intronic
1173845967 20:46188972-46188994 CCAAGAGTTTCACGGGGAGTGGG + Intronic
1174537714 20:51265381-51265403 CCAGGGTTTTTATTGGGGGCTGG + Intergenic
1174833584 20:53835798-53835820 CCCAGGGTTTTACTGGGGGCTGG + Intergenic
1174897832 20:54469501-54469523 CCAAGCTTTTTCCTGCAAGCTGG + Intergenic
1177265426 21:18777240-18777262 CCGAGGTTTTTATTGGGAGCTGG + Intergenic
1178707263 21:34886580-34886602 CAAAGATATCCACTGGGAGCCGG - Intronic
1182859110 22:33544020-33544042 CCAGGATTTTTATTGGGGGCTGG - Intronic
1183136047 22:35888852-35888874 CCAAGATTTTCAAAGGAAGCAGG - Intronic
1183573062 22:38668832-38668854 CCATGATTTTCACTGGGAACAGG - Intronic
1184143629 22:42595207-42595229 CCAAAGGTTTTACTGGGGGCTGG - Intronic
950699599 3:14731625-14731647 CCAAGCTTTTTAGTGGGTACTGG + Intronic
952719465 3:36517034-36517056 CCAATATTTATCTTGGGAGCAGG + Intronic
952975882 3:38695754-38695776 TCAAGATGCTTACTGGGAGTTGG - Intergenic
953674559 3:44990689-44990711 CCAAGATTTTTACTGGGAGCTGG + Intronic
954128436 3:48546816-48546838 CCAAGGTTTTTACTGGGGGCTGG - Intronic
955417481 3:58706031-58706053 CAAAGATTATCACTGGGATCAGG - Intergenic
957465435 3:80583920-80583942 CCAAGAGTATTACTGGTATCTGG - Intergenic
957898480 3:86455083-86455105 TCAGGATTTTTACTGGGGGATGG + Intergenic
958624716 3:96609531-96609553 CAAAGTTTTTCACTGGAAGCTGG - Intergenic
959931797 3:111993122-111993144 CTGGGGTTTTTACTGGGAGCTGG - Exonic
960601096 3:119459032-119459054 CCAGGGTTTTTATTGGGGGCTGG + Intronic
962265831 3:133943677-133943699 CCAAGATTATTTCTGGAAGTAGG + Intronic
962680543 3:137795401-137795423 CCAGTATTTTTACTGGCAGTAGG - Intergenic
965965308 3:174481860-174481882 CCCAGGTTTTTATTGGGGGCTGG + Intronic
965971127 3:174557977-174557999 CCAAGATTTTTACTGGGGAGTGG + Intronic
967322256 3:188206213-188206235 CCAAGATCTTCACAGGGATCTGG - Intronic
967421819 3:189281832-189281854 TCAAGGTCTTTTCTGGGAGCTGG - Intronic
968869172 4:3232824-3232846 CCAGGGTTTTTACTGGGGGCTGG + Intronic
968883585 4:3315025-3315047 CCAGGGTTTTTACTGGGGGCTGG - Intronic
969209830 4:5678269-5678291 CCAGAATTTTCACTGGGGGCTGG - Intronic
969972008 4:11057568-11057590 CCAACATGTTTACTGAGTGCTGG - Intergenic
970250279 4:14107762-14107784 CCAGGATTTTCACTGGGAAGAGG - Intergenic
972995272 4:44871126-44871148 CTAAGCTTTTTACTGAGAGCCGG + Intergenic
975033540 4:69654564-69654586 CCAAGATTTTTACTTGCTACAGG + Intergenic
979131819 4:117056735-117056757 CCAAGATTGTTAGTGAGGGCTGG + Intergenic
979184706 4:117773306-117773328 CCAAGAGTTTTTCAGGCAGCAGG - Intergenic
979518896 4:121643203-121643225 TCAAGATTTTTATTGGGGGCCGG + Intergenic
979815939 4:125104084-125104106 CAAACATTTTTACAGGGAGATGG + Intergenic
981707670 4:147678714-147678736 CCAGGGTTTCTACTGGGAGCTGG - Intronic
982016845 4:151163040-151163062 CCAGGGTTTTTATTGGGGGCTGG - Intronic
986157473 5:5190988-5191010 CCAGGGTTTTCTCTGGGAGCTGG - Intronic
986561541 5:9065278-9065300 CCATGACTTCTCCTGGGAGCTGG - Intronic
986868172 5:12014747-12014769 GTTAGATTTTTACTGGTAGCTGG - Intergenic
988119539 5:26942944-26942966 CCACAATTTTCACTGGCAGCAGG - Intronic
989231541 5:39092865-39092887 CCAAGGTTTTTATTGAGGGCTGG + Intergenic
990717054 5:58649093-58649115 CTAAGATGTTTACTGGGAAGTGG - Intronic
991221307 5:64222594-64222616 CTAAGGTTTTTATTGGGAGCTGG + Intronic
991984676 5:72272459-72272481 CCAAGGTTTTTACTGAGAGCTGG - Intronic
994074189 5:95632696-95632718 CCTTGATTTTTCCTTGGAGCAGG - Intergenic
994698503 5:103103196-103103218 CTAGGGTTTTTACTGGGCGCTGG - Intronic
995757679 5:115526950-115526972 TCAAGGTTTTTACTGGGGGCTGG - Intronic
996131373 5:119785274-119785296 CCCAAAGTTTTACTGGGAACTGG - Intergenic
999177509 5:149641627-149641649 CCATGACTTTTTCGGGGAGCAGG - Intergenic
1000267877 5:159655625-159655647 CTAAGAGTTTTACTGAGTGCGGG + Intergenic
1001745648 5:174090393-174090415 CCAGGGTTTTCACTGGGGGCTGG + Intronic
1007040733 6:38719783-38719805 CAAAGATTTTTACTGCGAATGGG + Intronic
1010063514 6:71653083-71653105 CCCAGTTTTTTACTGGGAGCTGG - Intergenic
1010381507 6:75231013-75231035 CTCAGCTTTTGACTGGGAGCAGG - Intergenic
1011454445 6:87532468-87532490 CCAAGGTTTTTATTGAGAGTTGG - Intronic
1012330637 6:97981399-97981421 CCAAGAATTCTACAGGGAGCAGG - Intergenic
1012436391 6:99219610-99219632 TCAGGATTATAACTGGGAGCGGG - Intergenic
1013952993 6:115807458-115807480 CCAAGATATTTACCCAGAGCAGG + Intergenic
1014617468 6:123621055-123621077 CCAAGCATTTTACTTGGAGCTGG - Intronic
1014989625 6:128057501-128057523 CTAAGGTTTTTAGTGGGAACTGG - Intronic
1017299753 6:152843147-152843169 CAATGATGGTTACTGGGAGCTGG + Intergenic
1019340808 7:507942-507964 CCAAGATTTTTCCAGGGCCCTGG - Intronic
1021194616 7:17661485-17661507 TCTAGATTATTACTGAGAGCGGG - Intergenic
1022445091 7:30463792-30463814 CCAAGTTTTCTACAGTGAGCAGG - Intronic
1026243573 7:68598247-68598269 CCAAGGTCTTTACTGGGGGCTGG + Intergenic
1026530832 7:71195919-71195941 GCAAGATTTTTATTGGGGGCTGG - Intronic
1026631587 7:72042509-72042531 CCAAGGTTTTCATTGGGAGCTGG + Intronic
1030631277 7:111898569-111898591 CCAAGCATTTTACTGGGTACTGG - Intronic
1031505873 7:122581613-122581635 GCACCATTTTTACTGGCAGCTGG + Intronic
1032871330 7:135989068-135989090 CTAGGTTTTTTACTGGGAGTAGG - Intergenic
1034393968 7:150805888-150805910 CCAGGGTTTTTATTGAGAGCTGG + Intergenic
1034685600 7:152968154-152968176 CCTTGATTTTTCCTGGGGGCAGG - Intergenic
1037206517 8:16327167-16327189 CAGAGATTTTTACTTGGAACTGG - Intronic
1038364204 8:26914608-26914630 CCATTCCTTTTACTGGGAGCAGG - Intergenic
1038754166 8:30325456-30325478 CCATGCATTTTACTGGGACCTGG + Intergenic
1038865117 8:31431143-31431165 GCAAGATTCTTGCTGAGAGCAGG - Intergenic
1042809205 8:72805543-72805565 CCAAGATCTTTATTTGCAGCAGG - Intronic
1043518864 8:81022765-81022787 CCCTGATTTTCACTGAGAGCTGG + Intronic
1044675826 8:94727742-94727764 TCAGGGTTTTTACTGGGGGCTGG + Intronic
1045953306 8:107876636-107876658 CCATAATTTTTTCTGGGAGCTGG + Intergenic
1046822698 8:118651501-118651523 CCAAGGTTTTTATTGGGAGATGG - Intergenic
1047242672 8:123107024-123107046 CCAGGATTTTTACTAGAGGCTGG + Intronic
1048271749 8:133034157-133034179 CTAATATTTTTGCTGGGAGTTGG + Intronic
1050318444 9:4426842-4426864 CTAAGACTTTTACTTGGATCAGG - Intergenic
1050587178 9:7124877-7124899 CGAAGATGTTTGCTGGGAGGGGG + Intergenic
1051728122 9:20109516-20109538 CCAGGATTTTTACTGGGGGCTGG - Intergenic
1053015364 9:34658807-34658829 CCAGGCTTTGTACTGGGTGCTGG + Intronic
1053481204 9:38417798-38417820 CCAGGGTTTTTACTGGGAGCTGG + Intronic
1053520722 9:38775993-38776015 CCAACATTTTATTTGGGAGCAGG - Intergenic
1054192878 9:61999986-62000008 CCAACATTTTATTTGGGAGCAGG - Intergenic
1054645529 9:67588705-67588727 CCAACATTTTATTTGGGAGCAGG + Intergenic
1054855937 9:69899759-69899781 CCAGAGTTTTTACTGGGAGCTGG - Intronic
1057012727 9:91620058-91620080 CCAGGATTTTTACTGGGGGCTGG + Intronic
1058373294 9:104294654-104294676 CCATGTTTTTTCCTGAGAGCTGG - Intergenic
1059071494 9:111142048-111142070 CCAAGATTTTTACTGGGGGCTGG + Intergenic
1060612517 9:124980579-124980601 CCAGGGTTTTTATTGGGAACTGG - Intronic
1061505384 9:131028969-131028991 CCAGGGTTTTTACTGGAGGCTGG + Intronic
1061864867 9:133486947-133486969 TCAAGATTTCTACTGTGGGCCGG + Intergenic
1187151149 X:16682734-16682756 CCAAGGTTTTTACTGGGGGCTGG - Intronic
1187156414 X:16724295-16724317 CCAGGACTTTTACTGGGGACTGG + Intronic
1189020384 X:37331118-37331140 CCAGGATTTTGACTGGAGGCTGG - Intergenic
1189047244 X:37606231-37606253 CCAAGGTTTTTATTGGGGGGTGG + Intronic
1189120359 X:38387822-38387844 CCAAGGCTTTTACTGGGGACTGG + Intronic
1190370973 X:49740318-49740340 CCAAGGTTTTTACTGGGGGTTGG + Intergenic
1190627384 X:52349854-52349876 CCAAGACTTTTACTTGATGCTGG - Intergenic
1190685860 X:52872555-52872577 CCCAGGTTTTTACTGGGGACTGG - Intergenic
1190700427 X:52984302-52984324 TGAAGACTTTTACTGGGGGCTGG + Intronic
1190847636 X:54208957-54208979 CCATGGTTTTCACTGGGGGCTGG + Intronic
1193149761 X:78112949-78112971 CCAAGATTTTTGTTGGGAACTGG + Intronic
1193698279 X:84735869-84735891 CCAGGGTTTTTACTGGAGGCTGG + Intergenic
1194675517 X:96789266-96789288 CCAAGGTTTTTATTGGGGGCCGG + Intronic
1194693425 X:97014511-97014533 CCAAGATTTATACTGGGATTAGG - Intronic
1194894824 X:99427345-99427367 CCAAGATTGTTACTAGGGCCAGG + Intergenic
1196282104 X:113833826-113833848 CCAAGGTTTTAACTGGGGGCTGG - Intergenic
1197973805 X:132143626-132143648 CCAACATTGTGACTTGGAGCAGG + Intergenic
1198088838 X:133307725-133307747 ATAATATTTTTATTGGGAGCAGG - Intronic
1198167805 X:134074459-134074481 CCAGGTTTTTTACTGGGGCCTGG - Intergenic
1198749531 X:139924693-139924715 CCAGGGTTTTTAGTGGGAGCTGG - Intronic
1199520166 X:148726275-148726297 CCAAGGTTTTTACTGGGGTCTGG + Intronic
1200870458 Y:8092557-8092579 TCATGATTCTTACTGAGAGCAGG + Intergenic
1200890133 Y:8314542-8314564 TCATGATTCTTACTGAGAGCAGG - Intergenic
1200906521 Y:8488972-8488994 ACATGATTTTTACTGACAGCAGG - Intergenic
1201327097 Y:12773578-12773600 CCAAGATTTTTACTGAAGGATGG + Exonic
1202245185 Y:22812766-22812788 TCACGATTCTTACTGAGAGCAGG - Intergenic
1202259305 Y:22953461-22953483 TCGTGATTTTTACTGGGAGTAGG - Intergenic
1202262394 Y:22983415-22983437 TCAAAATTCTTACTGAGAGCAGG - Intronic
1202398175 Y:24446512-24446534 TCACGATTGTTACTGAGAGCAGG - Intergenic
1202412291 Y:24587205-24587227 TCGTGATTTTTACTGGGAGTAGG - Intergenic
1202415384 Y:24617156-24617178 TCAAAATTCTTACTGAGAGCAGG - Intronic
1202455403 Y:25052930-25052952 TCAAAATTCTTACTGAGAGCAGG + Intronic
1202458489 Y:25082865-25082887 TCGTGATTTTTACTGGGAGTAGG + Intergenic
1202472606 Y:25223574-25223596 TCACGATTCTTACTGAGAGCAGG + Intergenic