ID: 953675158

View in Genome Browser
Species Human (GRCh38)
Location 3:44995311-44995333
Sequence TAATTTAGACAGTTGGACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 126}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953675153_953675158 12 Left 953675153 3:44995276-44995298 CCTGGCCAGGGGCATGCATGGTT 0: 1
1: 1
2: 1
3: 14
4: 214
Right 953675158 3:44995311-44995333 TAATTTAGACAGTTGGACCTGGG 0: 1
1: 0
2: 0
3: 6
4: 126
953675150_953675158 20 Left 953675150 3:44995268-44995290 CCACCACGCCTGGCCAGGGGCAT 0: 1
1: 3
2: 76
3: 526
4: 2926
Right 953675158 3:44995311-44995333 TAATTTAGACAGTTGGACCTGGG 0: 1
1: 0
2: 0
3: 6
4: 126
953675154_953675158 7 Left 953675154 3:44995281-44995303 CCAGGGGCATGCATGGTTTTATA 0: 1
1: 0
2: 1
3: 9
4: 117
Right 953675158 3:44995311-44995333 TAATTTAGACAGTTGGACCTGGG 0: 1
1: 0
2: 0
3: 6
4: 126
953675151_953675158 17 Left 953675151 3:44995271-44995293 CCACGCCTGGCCAGGGGCATGCA 0: 1
1: 1
2: 5
3: 61
4: 401
Right 953675158 3:44995311-44995333 TAATTTAGACAGTTGGACCTGGG 0: 1
1: 0
2: 0
3: 6
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953675158 Original CRISPR TAATTTAGACAGTTGGACCT GGG Intronic
902257086 1:15196817-15196839 TAATTCAGCTAGTTGGCCCTGGG + Intronic
903749345 1:25611101-25611123 TAATTTAGATTGTTGTAACTGGG - Intergenic
909923635 1:81412459-81412481 TAAGTTAGAGAGGTGGATCTGGG - Intronic
910353419 1:86326263-86326285 TAATTTGGACAATGGGATCTGGG + Intergenic
911065115 1:93781084-93781106 TGCTTTAGTCAGCTGGACCTTGG - Intronic
914689575 1:150013505-150013527 TAATTTAGACCATTGGTTCTGGG + Intergenic
920330570 1:205204422-205204444 TGATTTAGAAAGTTGGAACATGG - Intronic
922871682 1:228907216-228907238 AAATATATACAGTTGGCCCTCGG - Intergenic
923336692 1:232977161-232977183 TAATTTCGACAGGTGAACCATGG - Intronic
1065193254 10:23235102-23235124 TAATTTAGACAGTGCGATATTGG + Intronic
1065611101 10:27471285-27471307 TAATTTAGAAACATGGATCTAGG + Intergenic
1066057975 10:31699238-31699260 TGATTTTGACAGGTGGAGCTGGG + Intergenic
1068997344 10:63222807-63222829 TGATTGAGACAGATGCACCTTGG + Intronic
1069359639 10:67626967-67626989 TAATTTAGACATTTTTGCCTAGG + Intronic
1078680203 11:13468671-13468693 TAATTCAGACATTTTCACCTAGG - Intergenic
1080567020 11:33519751-33519773 TCATTTAGGCAGTTTGTCCTTGG + Intergenic
1088596103 11:111441494-111441516 TAATTCAGACTGTGGGATCTGGG - Intronic
1090211572 11:124924349-124924371 GAACCTAAACAGTTGGACCTAGG - Intronic
1091359096 11:134960505-134960527 TAAATTATAGACTTGGACCTAGG + Intergenic
1095479242 12:42617893-42617915 TAATTTAGACAATTTTGCCTGGG - Intergenic
1099162627 12:79262474-79262496 TAATTTATAGAGTTGGACAAGGG - Intronic
1099656266 12:85495890-85495912 TAATTTAGAGAGTTGTTCCTTGG + Intergenic
1100810884 12:98336851-98336873 AAATTTAGTCAGGTAGACCTTGG - Intergenic
1102319843 12:111923183-111923205 TAATTAAGACAGTGTGATCTTGG + Intergenic
1104277660 12:127344505-127344527 TAATTTAGACAGTTGTCCAGAGG + Intergenic
1104654659 12:130564986-130565008 TAATTTATACAGTTTGAGTTTGG - Intronic
1106702198 13:32241858-32241880 TATTATATACAGTGGGACCTTGG - Intronic
1109755276 13:66750436-66750458 TTCTTTACACAGTTGGTCCTGGG - Intronic
1111612058 13:90617270-90617292 TAATACAGACTCTTGGACCTTGG + Intergenic
1111884347 13:94000567-94000589 CAAGTTGGACAGTTGGAACTGGG + Intronic
1118910462 14:70057946-70057968 TAATCAAGACTGTTGGGCCTGGG - Intronic
1125264519 15:37863704-37863726 TCAGTTAGACAGATGCACCTGGG + Intergenic
1127363248 15:58263509-58263531 TACTTTAGATACTTGGCCCTAGG - Intronic
1138275201 16:55729245-55729267 TCATATACACAGTTAGACCTGGG + Intergenic
1138817604 16:60220914-60220936 TAATTTAGACATTTTTGCCTAGG - Intergenic
1140568824 16:76077747-76077769 TAATCAAGACAGTGGGACATTGG - Intergenic
1141186419 16:81790714-81790736 TGCTTTAGACAGTAGGACCTAGG - Intronic
1143686434 17:8520540-8520562 TCATTCAGACAGTTCTACCTGGG - Intronic
1145284132 17:21491276-21491298 TAATTTAGACATTTTTGCCTGGG + Intergenic
1145987543 17:29057261-29057283 TAATTTAGACAATTAGAGCCTGG - Intergenic
1146588440 17:34103829-34103851 TAATTAAGACAGTTAGATATTGG - Intronic
1154495886 18:14960736-14960758 TAAATTATAGACTTGGACCTAGG - Intergenic
1155650132 18:28131787-28131809 TAATTTAGAAAGATGGAAATGGG - Intronic
1158875697 18:61732734-61732756 TAATTAATTCAGTAGGACCTGGG - Intergenic
1163739148 19:18999999-19000021 AACTTAAGACAGTTGGACCAGGG - Intronic
1166426331 19:42681715-42681737 TAATTTAGATATTTGTGCCTGGG - Intronic
1166498359 19:43322736-43322758 TAATTTAGACATTTGTGCCTGGG + Intergenic
929454585 2:42056852-42056874 CATTTTAGACAGTTGGAGCCAGG - Intronic
935589309 2:104831166-104831188 TAATTTATACTGATGAACCTTGG - Intergenic
937133588 2:119532633-119532655 TAATTTAGACATTTTTTCCTGGG + Intergenic
937875302 2:126820691-126820713 TCATGTAGCCTGTTGGACCTAGG - Intergenic
944392008 2:199227636-199227658 TAATCTAGGCCCTTGGACCTTGG + Intergenic
1169546940 20:6660200-6660222 TAATTCAGAAAGTTATACCTAGG + Intergenic
1173163662 20:40671118-40671140 CAACTTAGACAGATGGAGCTGGG - Intergenic
1177040664 21:16106171-16106193 TAATTAAAACAATTAGACCTTGG + Intergenic
1185404349 22:50638517-50638539 TAGTTTAGAGACTTGGAGCTAGG - Intergenic
950332706 3:12169167-12169189 TAATTGAGAAAGTTGGACTATGG + Intronic
950844116 3:15998088-15998110 AAATTTGGACAGTGAGACCTTGG - Intergenic
951073899 3:18365921-18365943 TAATTTAGACAGTAACAGCTTGG + Intronic
953094511 3:39761769-39761791 TGATTTAGTCTGTTGGGCCTGGG + Intergenic
953675158 3:44995311-44995333 TAATTTAGACAGTTGGACCTGGG + Intronic
953763543 3:45714428-45714450 TAATTTAAAAAGTTAGACTTAGG + Intronic
956829431 3:73031008-73031030 TAATTTTTACAGTTGAAGCTGGG + Intronic
960316477 3:116184513-116184535 TAACTCAGACATTTTGACCTGGG + Intronic
960398921 3:117172004-117172026 TAATCTTGACAGTTCCACCTAGG - Intergenic
964471245 3:157058471-157058493 AAATTTATACAGTTGTCCCTTGG - Intergenic
965583269 3:170292100-170292122 AAATCGAGACAGTGGGACCTTGG + Intronic
967717972 3:192785280-192785302 TAATTTCGACAGTTCTACCGTGG + Intergenic
973244896 4:48000846-48000868 TAATTTATACTTTTGTACCTAGG + Intronic
974583344 4:63836323-63836345 CAATTCAGACAGTTTTACCTTGG + Intergenic
975438912 4:74387253-74387275 TAATAAATACAGTTGTACCTTGG - Exonic
976901625 4:90184419-90184441 TTCTTTAGAGAGTTGTACCTAGG + Intronic
978981353 4:114950101-114950123 TCATTTATACAGTTGGATTTAGG + Intronic
979225088 4:118275695-118275717 TAATGTAAACAGTTGTAACTTGG + Intergenic
981398504 4:144283366-144283388 TATTTCAAACAGTTAGACCTAGG - Intergenic
982283847 4:153714471-153714493 TAATTTAGTCAGTCATACCTCGG - Intronic
985562173 5:593722-593744 TAATTTAGCCAGTGGGACTCAGG + Intergenic
987729302 5:21747821-21747843 GAATTTTGACATTTGCACCTAGG + Intergenic
989263030 5:39439939-39439961 TAAATTAGACATTTGGAATTAGG - Intronic
989714879 5:44451104-44451126 TAATTTAGACATTTTTGCCTGGG - Intergenic
990711454 5:58584580-58584602 TAATTTAGCCAGTTGGCTCCTGG - Intronic
991314984 5:65291884-65291906 TAATTTATATAGTTCCACCTTGG + Intronic
991489460 5:67167816-67167838 CCTTTTAGACAGTTGGACCAGGG - Exonic
995246025 5:109936722-109936744 AAAATTAGACAGATAGACCTAGG - Intergenic
995350663 5:111171696-111171718 TAATTTAGGCACTGGGACATAGG + Intergenic
998205925 5:140156899-140156921 TAATTTAGACTGGGGGACCAGGG + Intergenic
999480226 5:151941310-151941332 TATTTTAGACAGTGGGAGTTTGG + Intergenic
1000411158 5:160936021-160936043 TAATCCAGGCTGTTGGACCTTGG + Intergenic
1000847184 5:166296450-166296472 TGATTTAGACAAGTGGACATGGG + Intergenic
1001063750 5:168518244-168518266 TAAATGAGACACTTGGAGCTGGG - Intronic
1004569843 6:16834599-16834621 TGATTTAAACAGTCTGACCTTGG + Intergenic
1005922432 6:30414706-30414728 TAATGAAGACTGTGGGACCTGGG - Intergenic
1008228405 6:48952289-48952311 TAATTAAGACATTTGTAACTTGG + Intergenic
1008726685 6:54430161-54430183 TTATTTTGACATCTGGACCTGGG + Intergenic
1009988219 6:70807272-70807294 TAATTGTGTCAGTTGGAGCTAGG + Intronic
1011582261 6:88882134-88882156 ATATTTAGGTAGTTGGACCTTGG - Intronic
1012330667 6:97981657-97981679 TAATTTAGCCAGATGTACTTAGG - Intergenic
1014752484 6:125270582-125270604 TAATCCAGACCCTTGGACCTTGG - Intronic
1016680807 6:146827615-146827637 TAATATAGAATGTTGGACCTGGG + Intergenic
1016761511 6:147742678-147742700 GAAGTTGGACAGTTGGACATTGG + Intergenic
1017575910 6:155803685-155803707 TAATTTAGACAGTGTGATTTTGG + Intergenic
1018281633 6:162192203-162192225 TAATTTAGATAATTGGAAATTGG - Intronic
1023180166 7:37474468-37474490 TAATTTGGCAAGCTGGACCTAGG + Intergenic
1024125243 7:46288150-46288172 TAATTTAGACTTTTGCAGCTGGG - Intergenic
1029134776 7:98361681-98361703 TAAATTAAACAGTTGGACTTAGG - Intronic
1030198600 7:106878474-106878496 TAATTTAGACTGCTGGACTCTGG + Intronic
1036539041 8:9685644-9685666 TAATTAATTCAGTTGGAGCTTGG + Intronic
1037969979 8:23164831-23164853 AAGGTCAGACAGTTGGACCTGGG - Intergenic
1038085338 8:24190448-24190470 TAAGCTAGACAGTTAGACCAAGG + Intergenic
1038086238 8:24199701-24199723 TAAATTAGACAGTTGGTAGTGGG + Intergenic
1039106928 8:34000088-34000110 TAATTGAAACAGTAGGTCCTTGG + Intergenic
1044046197 8:87435922-87435944 TAAATTAGATAGTTGGCACTAGG - Intronic
1048283875 8:133126336-133126358 TGACTTAAACAGTTGGGCCTTGG + Intronic
1048388449 8:133936366-133936388 TAATTAAGACAGTATGGCCTTGG - Intergenic
1052406955 9:28073203-28073225 TAAGTTTGAGAGTTGGACTTTGG - Intronic
1053270927 9:36748993-36749015 TAATTTAGACAGAAGGTCTTTGG - Intergenic
1056085056 9:83139715-83139737 TAGTTTATACAGTTGACCCTTGG - Intergenic
1056724903 9:89106313-89106335 TAATTTAGAGAGTCAGACATGGG + Intronic
1056956725 9:91088344-91088366 TAATTAAGACAGTGGAACATTGG - Intergenic
1057390206 9:94636563-94636585 AACCTTAGACAGTGGGACCTTGG - Intronic
1057711623 9:97450798-97450820 AAATTTAGAGAGTTTGAGCTGGG + Intronic
1059447966 9:114350835-114350857 TAAGTTAGACACTTGGATCCTGG - Intronic
1061639104 9:131937367-131937389 TAATTCAGACACGTGGATCTAGG - Intronic
1185842111 X:3401517-3401539 TAATTTGGTCAGCTGGGCCTTGG + Intergenic
1187651092 X:21407375-21407397 TAGTTAAGACAGATGTACCTGGG + Intronic
1188114750 X:26229289-26229311 AAATTTACACAAATGGACCTGGG - Intergenic
1188400727 X:29740706-29740728 TGAGTTAGACAGTTCGACCTTGG - Intronic
1189938460 X:46095083-46095105 AAATTTAGACCGTTCAACCTGGG + Intergenic
1190393395 X:49955012-49955034 TTTTTTAGACAGATAGACCTGGG + Intronic
1193988320 X:88274634-88274656 TAATTCAGAGAGTTGGTACTTGG + Intergenic
1195587646 X:106584090-106584112 TTGTTGATACAGTTGGACCTTGG - Intergenic
1196688945 X:118538265-118538287 TAATGTAGACAGATGAACTTAGG + Intronic
1199613122 X:149634482-149634504 GAATTTAGACACTTGGACTGGGG + Intergenic