ID: 953678381

View in Genome Browser
Species Human (GRCh38)
Location 3:45021073-45021095
Sequence ATGGAGAACCACGCTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953678381_953678391 24 Left 953678381 3:45021073-45021095 CCCTCCTCAGCGTGGTTCTCCAT 0: 1
1: 0
2: 1
3: 14
4: 135
Right 953678391 3:45021120-45021142 ATATCCAGAGTCTTTTAAGATGG 0: 1
1: 0
2: 0
3: 14
4: 172
953678381_953678385 -10 Left 953678381 3:45021073-45021095 CCCTCCTCAGCGTGGTTCTCCAT 0: 1
1: 0
2: 1
3: 14
4: 135
Right 953678385 3:45021086-45021108 GGTTCTCCATTGGTCTCCCGTGG 0: 1
1: 0
2: 0
3: 5
4: 74
953678381_953678387 -2 Left 953678381 3:45021073-45021095 CCCTCCTCAGCGTGGTTCTCCAT 0: 1
1: 0
2: 1
3: 14
4: 135
Right 953678387 3:45021094-45021116 ATTGGTCTCCCGTGGTCTCCAGG 0: 1
1: 0
2: 2
3: 4
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953678381 Original CRISPR ATGGAGAACCACGCTGAGGA GGG (reversed) Intronic
911185856 1:94904452-94904474 ATGGAGAACACAGCTGAGGCAGG + Intronic
916281610 1:163057855-163057877 AAGGAGAACCAAGCTGAGGAGGG - Intergenic
916964005 1:169916584-169916606 ACGGAGACCCAGGATGAGGAGGG - Intergenic
917967361 1:180187062-180187084 CTGCAGACCCACACTGAGGAGGG - Intronic
918043318 1:180926361-180926383 ATGCAGTACCACACTGAGCATGG - Intronic
918345179 1:183601565-183601587 ATGGTGAATCAGGCTGAGCACGG + Intergenic
920045537 1:203129931-203129953 CTGGACACCCACACTGAGGACGG - Intronic
921573615 1:216807770-216807792 AAAGAGAACCAAGATGAGGATGG + Intronic
923176982 1:231476221-231476243 ATGCAGAAGCACGGGGAGGAGGG - Intergenic
923915028 1:238492311-238492333 TTGGAGAACCAGCCTGAGGGAGG + Intergenic
1064426273 10:15232425-15232447 ATGGCGAAACAAGCTGGGGAAGG - Intronic
1065675822 10:28173148-28173170 AAGGAGAACCAGGGTGAGCAGGG + Intronic
1068258473 10:54544549-54544571 ATGGAGTACCACCCTTGGGAAGG - Intronic
1071108202 10:82123521-82123543 ACGGATAACCCTGCTGAGGACGG + Intronic
1071220756 10:83462481-83462503 TTGTAGAACCACCTTGAGGAAGG + Intergenic
1077392806 11:2307817-2307839 ATGGAGACCCAGGCAGAGTATGG + Intronic
1077707150 11:4497661-4497683 ATGGAAAACTAGGCTGTGGAGGG + Intergenic
1082081934 11:48019042-48019064 ATGGAGAACCCCTCTCAGGAGGG + Intronic
1083841902 11:65309349-65309371 ATGGAGAAACACCCAGAGCAGGG - Intergenic
1084468452 11:69341066-69341088 ATGGAGAAGCACGTTGGAGAAGG + Intronic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1093427163 12:19041050-19041072 TTGGAGAACAAAGCTGAGGAAGG + Intergenic
1094285676 12:28790367-28790389 AGGCAGAACAACGATGAGGAAGG - Intergenic
1095957993 12:47817579-47817601 AGGGAGAGCCAAGCTGTGGAGGG + Intronic
1097306226 12:58072154-58072176 ATGCAGCACCATGCTGATGAGGG - Intergenic
1097610895 12:61818578-61818600 ATGGAGCACCACTCTGAGGCAGG + Intronic
1106307133 13:28522686-28522708 ATTGAGGACCAGGCTGAGAAGGG - Intergenic
1107096518 13:36543270-36543292 ATGGAGAATCAAGCTGATTAAGG + Intergenic
1111372553 13:87336026-87336048 CTGGAGATCCATACTGAGGATGG - Intergenic
1112364149 13:98742427-98742449 ATGGACACCCAAGCTGAGGGAGG - Intronic
1112464182 13:99629244-99629266 ATAAAGAACCACTCTTAGGATGG - Intronic
1112699959 13:101996326-101996348 ATGGAGAAACTTTCTGAGGAGGG + Intronic
1115423302 14:33222986-33223008 ACGGAGAACCACGTTGATGGGGG - Intronic
1115875480 14:37857154-37857176 TTGGAGAACCACGCTCAGACTGG - Intronic
1116001094 14:39243573-39243595 ATGAAGAACCAGGCTGGGGGTGG + Intronic
1116964109 14:50997083-50997105 ATGGAGAATCCCGGTGAGGTGGG + Intronic
1117313083 14:54547884-54547906 TTAAAGAACCAGGCTGAGGAAGG - Intergenic
1117376202 14:55120465-55120487 ATGGAAAGCCATGCTGTGGATGG - Intergenic
1119473602 14:74914069-74914091 ATGGAGAAACAGGCTCAGGAGGG - Intronic
1120930739 14:89845761-89845783 AGGGAGAAGCAGGCTGAAGATGG + Intronic
1126326112 15:47479333-47479355 ATAGAGAAACAGGTTGAGGATGG - Intronic
1127705382 15:61541777-61541799 ATTGAGGACCACGCTGCTGATGG + Intergenic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1136539539 16:30921796-30921818 CTGGAGGACCCCGATGAGGAGGG + Intergenic
1138308658 16:56004085-56004107 CAGGTGAACCACCCTGAGGACGG - Intergenic
1138488403 16:57361483-57361505 ATGGAGAAACAGGCTTAGCAAGG + Intronic
1139597237 16:67965475-67965497 ATTGAAAACCATGCAGAGGAAGG - Intronic
1143367435 17:6417323-6417345 ATGGAGAAAGAGGCTGAGCAAGG + Intronic
1143523803 17:7461389-7461411 GTAGAGACCCACGCTGGGGAAGG + Exonic
1146761049 17:35479106-35479128 ATTCAGAACCAGGTTGAGGAAGG - Exonic
1147836748 17:43338306-43338328 ATGGATAACCAGGCTGTGGAGGG + Intergenic
1148144343 17:45353216-45353238 AAGGGGAAACACACTGAGGAGGG - Intergenic
1148245602 17:46027942-46027964 TTGGAGAACAAAGATGAGGAGGG - Exonic
1148990339 17:51660627-51660649 ATGGAGCATCACGCTGAGAAAGG - Intronic
1149095982 17:52841565-52841587 ATGGAGAACTAAGATTAGGATGG + Intergenic
1150143490 17:62749768-62749790 ATTCAGAACCACTCGGAGGAGGG - Intronic
1151557891 17:74855809-74855831 AGGCAGAACCATGCAGAGGAGGG - Intronic
1153284770 18:3448018-3448040 AAGGAGAACCACGGGGAAGAGGG + Intronic
1157991769 18:52504800-52504822 CTGGAGAAGCAGGCTGAGGTTGG - Intronic
1162531590 19:11239352-11239374 ATGGAGAAACAGGCTCAGCATGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
927582242 2:24262529-24262551 AGGGAGAAACACTGTGAGGATGG - Intronic
929943034 2:46349275-46349297 ATGGACAGCCAGGCTCAGGAGGG - Intronic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
936011697 2:108929213-108929235 ATGGAGAATGACGCTGAGTGTGG - Exonic
936022464 2:109005366-109005388 AGGGAGATCCAGGCTGTGGAAGG - Intergenic
943366209 2:186969859-186969881 AAGGAGAAACAAGCTGAAGAAGG + Intergenic
946007891 2:216541077-216541099 ACGGGGACCCACGCTAAGGAGGG + Intronic
946028439 2:216686812-216686834 ATGCAGCACCACGCCCAGGATGG + Intronic
948394241 2:237632655-237632677 TTGGAGAACCAAGCTGGGGATGG + Intronic
1168811016 20:704597-704619 AGGGAGACCCAAGGTGAGGATGG - Intergenic
1168835958 20:877621-877643 ACCAAGAACCAGGCTGAGGAAGG + Intronic
1169783444 20:9333315-9333337 AGGGAGAGCCTCTCTGAGGAGGG + Intronic
1169975584 20:11323643-11323665 ATGGATCACCATTCTGAGGAAGG - Intergenic
1170567853 20:17616796-17616818 ATGAAGAGCCACGTAGAGGATGG - Exonic
1171820387 20:29831223-29831245 ATGGAGAACCACGAGAAAGAAGG + Intergenic
1173613861 20:44390215-44390237 ATGGAGAAACACGCTCAGAAAGG + Intronic
1174840660 20:53898530-53898552 ATGGAGAACCTCGATTTGGACGG + Intergenic
1175657647 20:60786079-60786101 GTGGAGAGCCACGCTGGGGGAGG + Intergenic
1177953271 21:27565851-27565873 CTGGAGAACCAAGCTGAGGCTGG - Intergenic
1178582964 21:33851277-33851299 ATGGAGACCCAGCCTCAGGAGGG + Intronic
1178887676 21:36496656-36496678 ATGGAGAAGAAAGCAGAGGAAGG + Intronic
1181910055 22:26231445-26231467 ATTGAGAATCAAGCTGAGGTAGG - Intronic
1183733080 22:39629188-39629210 GTGGAGCACCAGGGTGAGGACGG - Intronic
1183910364 22:41074695-41074717 ATGGAGATCCTCACTGAGCACGG - Intergenic
1185234770 22:49705352-49705374 CAGGAGAACCACGAGGAGGACGG + Intergenic
953678381 3:45021073-45021095 ATGGAGAACCACGCTGAGGAGGG - Intronic
953766326 3:45746545-45746567 ATGGAGGACCAGGCAGAGAAGGG + Intergenic
956366350 3:68507297-68507319 ATGGAGAACCATGATGAGACAGG + Intronic
956647436 3:71470230-71470252 ATGAAGAAACAGGCTCAGGAAGG - Intronic
957261392 3:77906519-77906541 ATGGAGAAGGAGGCTGAAGAAGG + Intergenic
962702301 3:138011564-138011586 AAAGAGAACCAGACTGAGGAGGG + Intronic
964936759 3:162098617-162098639 ATGGAGACCGAGTCTGAGGAGGG + Intergenic
966242179 3:177766830-177766852 ACAGGAAACCACGCTGAGGATGG + Intergenic
967719356 3:192799083-192799105 ATGGAGAACCACTTTTGGGATGG - Exonic
967948179 3:194820558-194820580 AAGGAGAACCATGGAGAGGAGGG + Intergenic
969966699 4:11003864-11003886 ATGGAGAAACAGGCTCAGGGAGG + Intergenic
970457004 4:16234435-16234457 ATGGAAAACTGGGCTGAGGACGG + Intergenic
971497899 4:27287420-27287442 ATGGAGAAACACTCTGTGGATGG + Intergenic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
982139038 4:152299777-152299799 GTTGAGAACCACACTGAGAAAGG - Intergenic
982528931 4:156513809-156513831 TTGGAGATCCAGGCTGAGAAAGG + Intergenic
984499252 4:180537518-180537540 ATGGTCAACCACTCTGTGGAGGG - Intergenic
985157396 4:187003889-187003911 AAGGAGAACCACGCTGCTCATGG + Intergenic
986739557 5:10694184-10694206 ATTCAGAACCACGCAAAGGAGGG + Intronic
987909479 5:24123055-24123077 ATGAAAAACCAGGCTGAGGTGGG - Intronic
990568292 5:57052249-57052271 ATGGAGAGCCACACTGGGGGAGG - Intergenic
991226131 5:64274895-64274917 ATGGAGGACCATGCTGATGCAGG - Intronic
991499230 5:67259637-67259659 GTGGTGAAGCACGCTGAGCAAGG + Intergenic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
995862339 5:116654175-116654197 ATTGAAAACCACACTGAGGTGGG - Intergenic
996249878 5:121316683-121316705 ATGATCAACCAAGCTGAGGATGG - Intergenic
998775239 5:145592316-145592338 AAGGAGAATGACACTGAGGAAGG + Intronic
1000229819 5:159305240-159305262 CTGGAGGACCAAGCTGGGGATGG - Intergenic
1000639641 5:163686313-163686335 CCGGAGAACCAAGCTGAGGAAGG + Intergenic
1003093591 6:3124755-3124777 ATGTAGAACCACGGATAGGAAGG + Intronic
1007041055 6:38722810-38722832 ATGGAGAAGGATGCTGAAGATGG + Exonic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1013374010 6:109496598-109496620 AAGGAGAGCCAGGATGAGGAGGG - Intronic
1017955758 6:159176507-159176529 TTGGAGAAAGATGCTGAGGAAGG + Intronic
1018007294 6:159634262-159634284 ATGGAGAAACACCCTGGGGCAGG + Intergenic
1018988890 6:168658531-168658553 CTGTAGCACCAGGCTGAGGAGGG - Intronic
1019668791 7:2267094-2267116 ATGGAGAAACAGGCTCAGGGAGG - Intronic
1020794420 7:12663125-12663147 ATGAAGAACTACGCTGAGGTAGG - Intergenic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1022530886 7:31066199-31066221 ATGGAGGATCAGGCTGAGGTGGG + Intronic
1026628988 7:72021377-72021399 ATGGAGGTCCACTCTGATGATGG - Intronic
1031339596 7:120582597-120582619 ATGGAGAAAGAGGCAGAGGAGGG - Intronic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1034330418 7:150277796-150277818 CTGTAGAACCACGCAGAGGCAGG - Intronic
1034410735 7:150940813-150940835 ATGAACAACCACCCAGAGGACGG + Intergenic
1034667624 7:152832052-152832074 TTGTAGAACCACGCGGAGGCAGG + Intronic
1035965979 8:4192435-4192457 ACGGAGAGCCACACAGAGGAAGG - Intronic
1037923091 8:22821683-22821705 AGGGAGAAAGAGGCTGAGGAGGG + Intronic
1039582770 8:38680582-38680604 ATGGAGAAAGACGTTAAGGAAGG + Intergenic
1046598446 8:116288798-116288820 ATGCAGAACTGGGCTGAGGACGG + Intergenic
1047523519 8:125613728-125613750 ATGGAAACCGAAGCTGAGGAAGG - Intergenic
1051365451 9:16318602-16318624 ATGAAGAACGACCTTGAGGAGGG + Intergenic
1051895248 9:21979788-21979810 CTGGAGAACCCAGCTGAGGGTGG + Intronic
1055011634 9:71572914-71572936 ATGGAAGACCAAGCTGAGAATGG + Intergenic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1057928068 9:99170573-99170595 ATGGGGAAACAGGCTGAGAAAGG + Intergenic
1058006199 9:99917992-99918014 AGGTAGAACCAAGTTGAGGATGG - Intronic
1062406467 9:136399215-136399237 AGGGAGAGCCACGCCAAGGACGG - Intergenic
1203372045 Un_KI270442v1:316499-316521 ATGGAGAACCACGAGAAAGAAGG + Intergenic
1187723495 X:22176614-22176636 ATGGAGATAGACGCAGAGGAAGG - Intronic
1188982197 X:36736416-36736438 ATGGCCAACCACACTGAGAAGGG - Intergenic
1192080246 X:68040809-68040831 ATGGAGAAACATACTGAGGGGGG - Intergenic
1196731717 X:118947582-118947604 ATGGAGAATCAGGCTGGGCATGG + Intergenic
1200052096 X:153438978-153439000 ATGGAAGACCAGGCTGAGGGAGG - Intergenic
1201686016 Y:16703129-16703151 AAGGAAAACCACCCTCAGGAAGG - Intergenic