ID: 953682365

View in Genome Browser
Species Human (GRCh38)
Location 3:45049374-45049396
Sequence ATGCTGGCAATCTGTGAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953682365_953682373 29 Left 953682365 3:45049374-45049396 CCTATCTCACAGATTGCCAGCAT No data
Right 953682373 3:45049426-45049448 TCTGTAATCACGTCTGAGTAGGG No data
953682365_953682369 -9 Left 953682365 3:45049374-45049396 CCTATCTCACAGATTGCCAGCAT No data
Right 953682369 3:45049388-45049410 TGCCAGCATCAGACAGGGGCTGG No data
953682365_953682372 28 Left 953682365 3:45049374-45049396 CCTATCTCACAGATTGCCAGCAT No data
Right 953682372 3:45049425-45049447 TTCTGTAATCACGTCTGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953682365 Original CRISPR ATGCTGGCAATCTGTGAGAT AGG (reversed) Intergenic
No off target data available for this crispr