ID: 953684638

View in Genome Browser
Species Human (GRCh38)
Location 3:45067057-45067079
Sequence TTTGAGGGCATCACTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953684638_953684642 -2 Left 953684638 3:45067057-45067079 CCAGCAGCAGTGATGCCCTCAAA No data
Right 953684642 3:45067078-45067100 AAGGCCAGTCCCCTCCCCACTGG No data
953684638_953684651 18 Left 953684638 3:45067057-45067079 CCAGCAGCAGTGATGCCCTCAAA No data
Right 953684651 3:45067098-45067120 TGGTTCTCTGTGGCTTCTCAAGG No data
953684638_953684646 8 Left 953684638 3:45067057-45067079 CCAGCAGCAGTGATGCCCTCAAA No data
Right 953684646 3:45067088-45067110 CCCTCCCCACTGGTTCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953684638 Original CRISPR TTTGAGGGCATCACTGCTGC TGG (reversed) Intergenic
No off target data available for this crispr