ID: 953688471

View in Genome Browser
Species Human (GRCh38)
Location 3:45096827-45096849
Sequence CTCTGGGGTAACCACAGTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953688471_953688483 15 Left 953688471 3:45096827-45096849 CCGTGACTGTGGTTACCCCAGAG 0: 1
1: 1
2: 0
3: 17
4: 123
Right 953688483 3:45096865-45096887 AAAGACAGACTGAGTGGTCAAGG 0: 1
1: 0
2: 2
3: 16
4: 266
953688471_953688482 9 Left 953688471 3:45096827-45096849 CCGTGACTGTGGTTACCCCAGAG 0: 1
1: 1
2: 0
3: 17
4: 123
Right 953688482 3:45096859-45096881 GGGAGTAAAGACAGACTGAGTGG 0: 1
1: 0
2: 1
3: 30
4: 306
953688471_953688484 18 Left 953688471 3:45096827-45096849 CCGTGACTGTGGTTACCCCAGAG 0: 1
1: 1
2: 0
3: 17
4: 123
Right 953688484 3:45096868-45096890 GACAGACTGAGTGGTCAAGGAGG 0: 1
1: 0
2: 1
3: 13
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953688471 Original CRISPR CTCTGGGGTAACCACAGTCA CGG (reversed) Intronic
900120406 1:1046433-1046455 CCCTGGGGTGGTCACAGTCACGG - Exonic
900850200 1:5136641-5136663 CTCTGGGGTAATGACACCCAAGG - Intergenic
900975642 1:6014631-6014653 CTCTGGAGTAAACACCATCAAGG - Intronic
901400320 1:9011149-9011171 TTCTGTGGGAACCACAGTAAAGG + Intronic
901769751 1:11524259-11524281 CTCTGGGGGCACCACAGACCAGG - Intronic
906414381 1:45608858-45608880 CTCTGGTGATACAACAGTCAAGG - Intronic
907393695 1:54175158-54175180 TTCTGGGAAACCCACAGTCAGGG - Intronic
907742353 1:57179334-57179356 CTTTGGGGTTTCCCCAGTCACGG - Intronic
908108914 1:60875186-60875208 CTCTGGGGGAAGCAGAGTCCTGG - Intronic
913028694 1:114874107-114874129 CTCTGTGGGAACCAGAGTCAGGG - Intronic
915459200 1:156059689-156059711 CACTGGGGGAACCAGAGTAAGGG - Intergenic
916932642 1:169594799-169594821 CTCTGGGGAAACTTCAGTTATGG - Exonic
918098447 1:181353264-181353286 CTCTGGGGATACCACAAACATGG + Intergenic
918565133 1:185920287-185920309 CTCTGGGCTAACCAGGGTAACGG - Intronic
918936096 1:190924393-190924415 CTCTGGGGTTATCAAAGACATGG + Intergenic
920147230 1:203872523-203872545 CTCTGGGGCATCCACAGGAAGGG + Intergenic
923520330 1:234730564-234730586 CTCTGGGGTCACTGCAGACAAGG - Intergenic
923623789 1:235598007-235598029 GTCTTGGGTAGCCAGAGTCAGGG - Intronic
1063158301 10:3399786-3399808 CTCTGGAGCAACAACAGTGAAGG - Intergenic
1065295398 10:24269624-24269646 CTCTGGGCTTACCACACTGAAGG + Intronic
1067343702 10:45423211-45423233 CTGAGGGGCAACCAGAGTCAAGG + Intronic
1069565261 10:69459806-69459828 CTCTGGGGTACCCACAGAGGAGG - Intronic
1069968636 10:72144954-72144976 CTGTGAGATAACCACAGTAAAGG - Intronic
1071976906 10:90964514-90964536 CTTCTGGGTCACCACAGTCAAGG - Intergenic
1072292140 10:93974072-93974094 TTCTGGGGTTACCATGGTCAAGG + Intergenic
1076648547 10:131971197-131971219 CTCTGGGGGAGCCCCACTCAGGG + Intronic
1076736858 10:132462845-132462867 CTGTGTGGAACCCACAGTCATGG + Intergenic
1076978661 11:193648-193670 CTCTGGTGCAACCACAGCCCTGG - Intronic
1077246206 11:1540195-1540217 CCCTGGGGTAAACAGAGCCAGGG + Intergenic
1078457552 11:11486957-11486979 GGCTGGGGAAACCACAGTGAGGG - Intronic
1079390043 11:20014232-20014254 CCCTGTGGTAGACACAGTCAAGG + Intronic
1081334081 11:41842692-41842714 TTTTGGGGTATCCACACTCATGG - Intergenic
1082874347 11:57972753-57972775 CTCTGGGGGAATCCCAGTCCTGG - Intergenic
1082884361 11:58067530-58067552 CTCTGAGACAAACACAGTCAAGG + Intronic
1082896481 11:58195873-58195895 CTCTGTGGGTTCCACAGTCATGG - Intergenic
1083990104 11:66241618-66241640 TTCTTTGGTGACCACAGTCATGG - Exonic
1084757261 11:71247803-71247825 CTCTGGGGTTAGCTCAGTGAGGG - Intronic
1090586794 11:128221862-128221884 CTCTGGGGTAAACAAAGACATGG - Intergenic
1093214761 12:16349451-16349473 CTCTGGGCTACCCACCATCAAGG - Intronic
1096466824 12:51851281-51851303 CTCTGGGGTGACCTCACTCCTGG + Intergenic
1102895389 12:116594517-116594539 TCCTGGGGAAACCACAGTAAAGG - Intergenic
1106434707 13:29713173-29713195 CTCTGGGGTGACTTCGGTCAAGG - Intergenic
1107235164 13:38159846-38159868 CTCTTGGGAAACCACAGGTAGGG - Intergenic
1110136753 13:72077173-72077195 TTCTGAGGTAACCACAGGCAGGG - Intergenic
1112813694 13:103248953-103248975 CTCTGGGGTTCCCACAGGCAGGG + Intergenic
1119164513 14:72480942-72480964 CTCTGGGATGTCTACAGTCAGGG + Intronic
1120210554 14:81629658-81629680 CTCTGGGGGAACCTCAGCAATGG - Intergenic
1121635132 14:95449107-95449129 CACTGGGGACACCACAGTGACGG + Intronic
1122026550 14:98881794-98881816 CATGGGGGTAACCACACTCATGG + Intergenic
1125162760 15:36665345-36665367 CTCTGCTGTACCCACAATCATGG - Intronic
1125533985 15:40432478-40432500 CTCTGGGGGGACTACAGTCTGGG - Intronic
1126132245 15:45353138-45353160 CTCTGGGGTAGCCAGAGTGGAGG + Intergenic
1126760138 15:51962295-51962317 ATCTGGGGTAAACACACTCAGGG + Intronic
1127796125 15:62439900-62439922 CTCTGGGTTAACCAGGGTCAGGG + Intronic
1128707114 15:69844349-69844371 CTCTGGGGTGCACACACTCAGGG + Intergenic
1130974250 15:88760901-88760923 CTTTGGGGAAAACACAGTAAAGG - Intergenic
1132781999 16:1632387-1632409 CTCGGGGGTGCCCACAGGCAGGG + Intronic
1134339727 16:13333942-13333964 CTCTGTTGTAACTACAGCCACGG + Intergenic
1140878968 16:79180126-79180148 CTCTGGGGAATCCAGAGTCTTGG + Intronic
1142466089 17:138139-138161 CTCTGGTGCAACCACAGCCCTGG - Intronic
1142626874 17:1197816-1197838 CTCTGGGGAAAACCAAGTCACGG - Intronic
1146797477 17:35793275-35793297 ATCTGGGGCCACCACAGGCATGG + Intronic
1148111313 17:45146013-45146035 TTCTGGGGTACCCCCAGTCAGGG - Intergenic
1150750302 17:67855634-67855656 CTCAGGGTTTACCTCAGTCAGGG + Intronic
1152254296 17:79228414-79228436 CTCTGGGGAAAACACAGACTTGG + Intronic
1154979699 18:21492591-21492613 CTGTTGGAAAACCACAGTCAAGG + Intronic
1155489498 18:26385890-26385912 CTCTCAGTTATCCACAGTCAAGG - Intronic
1155810889 18:30233747-30233769 CTCTGGATTCACAACAGTCAAGG + Intergenic
1156266471 18:35492942-35492964 CTCTGGTATAACCAAATTCATGG - Intronic
1157486981 18:48094884-48094906 CTCTGGGGAAACAGCAGTCAAGG + Intronic
1159289428 18:66396490-66396512 CTCTAGGGTCACCCCAGTCCAGG - Intergenic
1160924208 19:1535310-1535332 CTCTGGGGGAGCCACAGGAATGG - Exonic
1164841659 19:31397579-31397601 CTCTGGGGGAACTCCAGGCAGGG + Intergenic
1165079045 19:33297428-33297450 CTCTTGGCTAAACAAAGTCAGGG + Intergenic
1165273359 19:34729424-34729446 CTCTGGTGTGAGCAAAGTCAAGG + Intergenic
1165657680 19:37548691-37548713 CACTGAGGTCACGACAGTCAGGG + Intronic
1166803370 19:45471183-45471205 CTCTGGGGTGAGCTGAGTCAGGG - Exonic
925121181 2:1419636-1419658 CTCTGGGGCAACTACAGGAAGGG - Intronic
925992064 2:9261790-9261812 ACCTGGGGTTACCTCAGTCAGGG + Intronic
926038732 2:9655788-9655810 ATCTTTGGTGACCACAGTCAAGG - Intergenic
927199403 2:20568991-20569013 CTCTGGGGTAAGCAGAGTACTGG + Intronic
931231115 2:60375676-60375698 CTCTGAGGTATTCACAGTTATGG - Intergenic
932892499 2:75609150-75609172 CTCAGTGGTAACCTCAGCCAGGG - Intergenic
934704042 2:96463872-96463894 CTCTGGGGGAAGCAGAGGCAGGG + Intergenic
935292392 2:101621498-101621520 CTCTGGGGCAGCCACGGTCAAGG - Intergenic
938187116 2:129241216-129241238 CTGTGCTGCAACCACAGTCAAGG + Intergenic
944478422 2:200130091-200130113 CTCAGGGGCCACCATAGTCAGGG + Intergenic
945063541 2:205929035-205929057 CTCTGGGCTCACCTAAGTCATGG - Intergenic
1168852906 20:988886-988908 CTGTGGGGTAGACACAGTCATGG - Intronic
1169050626 20:2574213-2574235 TTCTGGGATAACCTCAGTCACGG + Intronic
1171486557 20:25490185-25490207 CGATGGGGTAGCCACAGTCTGGG - Intronic
1172050065 20:32110281-32110303 CTCTGGGGTAGCGGCAGTCAAGG - Intronic
1178894707 21:36548874-36548896 CACTGGGGTCACTGCAGTCAGGG - Intronic
1179503356 21:41823521-41823543 CTCTGGGGAAACCACAACCCGGG + Intronic
1182252023 22:29008292-29008314 CTCGGGGGAATCCACAGCCATGG - Intronic
1185078430 22:48695812-48695834 CTCTGGCGTCACCAGAGTCCTGG + Intronic
1185193528 22:49453640-49453662 CTATGGCCTAACCACAGTCAAGG - Intronic
1185316487 22:50181448-50181470 CTTTGGTGGAACCACAGTGAAGG - Intergenic
1185370427 22:50458456-50458478 CTCTGTGGGAAGCACAGGCATGG + Intronic
950413237 3:12852821-12852843 CTCTTGGCTGGCCACAGTCAGGG - Intronic
950428298 3:12936403-12936425 CGCTGAGGTCACCACACTCAGGG + Exonic
950786614 3:15441722-15441744 CCCTGGGGTATCCACAGGAATGG + Exonic
950873747 3:16251491-16251513 CTCTGGGGGAGCTAGAGTCATGG - Intergenic
953032116 3:39185945-39185967 CTCAGAGGGAACCCCAGTCAAGG - Exonic
953688471 3:45096827-45096849 CTCTGGGGTAACCACAGTCACGG - Intronic
953688649 3:45098414-45098436 CCCTGGGGTAACCACAGTCACGG - Intronic
953819792 3:46196763-46196785 TTCAGGGGTAATCACAGGCATGG - Intronic
961703613 3:128766374-128766396 GTCCTGGGTAACCACCGTCATGG + Intronic
963472192 3:145754152-145754174 ATCTGGGGGAACCACAGACAAGG + Intergenic
965605862 3:170496912-170496934 CTCTGGGGGAGCCACAGTAGAGG - Intronic
970911729 4:21284778-21284800 CTTTTGGGTAACTACAGCCAAGG - Intronic
971715707 4:30173363-30173385 CTCTGATGAAACCACAGACAAGG + Intergenic
973335544 4:48952054-48952076 CTCTGGGGCAGGGACAGTCATGG + Intergenic
978657928 4:111088626-111088648 CTCTGAGGAAACCAGTGTCAGGG + Intergenic
982120511 4:152138761-152138783 CTCTGGGGCCAACACAGGCAGGG + Intergenic
983208994 4:164939682-164939704 CTCTGTGAGAAGCACAGTCAGGG - Intergenic
984035410 4:174661703-174661725 GTCTGGTGGAACCAGAGTCAAGG - Intronic
985338114 4:188917781-188917803 CTCTTGGGTGACCAGAGGCATGG + Intergenic
994704386 5:103183244-103183266 CTCTGGGCTAGACACACTCAGGG - Exonic
995055908 5:107758503-107758525 CACTGGGGTCACCACAGACCAGG - Intergenic
1005787746 6:29263500-29263522 ATGTGGGGCTACCACAGTCATGG - Intergenic
1006525137 6:34597846-34597868 CTCAGAGGCAACCACAGGCAGGG - Intronic
1011408808 6:87044320-87044342 TTTTTGGGTATCCACAGTCATGG - Intergenic
1014064488 6:117109199-117109221 CTCTGGGGTTCCCACTATCATGG + Intergenic
1020210062 7:6152471-6152493 TTCTGGGGTTGCCACAGTGATGG - Intronic
1022503283 7:30895779-30895801 CTCTGGGGTGACCACAGTGTGGG + Intergenic
1023938804 7:44757307-44757329 CTCTGGGGTGAGCACAGTCCTGG + Intronic
1025014794 7:55430455-55430477 CTCTGGGGGGACCACAGGGATGG + Intronic
1025034867 7:55587748-55587770 CTGTGGAGGAAGCACAGTCAGGG - Intergenic
1026734619 7:72941900-72941922 CGCTGGGTTTATCACAGTCAGGG + Exonic
1026784954 7:73296812-73296834 CGCTGGGTTTATCACAGTCAGGG + Intergenic
1027109123 7:75423118-75423140 CGCTGGGTTTATCACAGTCAGGG - Exonic
1028688377 7:93620009-93620031 CTCTTGGCTAAGCACACTCAAGG + Intronic
1031812268 7:126385536-126385558 CTATAGGGTAACCACATGCAAGG - Intergenic
1048848744 8:138624127-138624149 CTCTTGGGTGAGCACAGTGATGG + Intronic
1049535278 8:143177531-143177553 CTCTGGGGTAACCAGAACCAGGG + Intergenic
1059363672 9:113768395-113768417 TGCCAGGGTAACCACAGTCAAGG + Intergenic
1060134291 9:121136765-121136787 CTCTAGGGAAAGCACAGACATGG + Intronic
1060540755 9:124428707-124428729 CCCAGGGGTCCCCACAGTCAAGG - Intergenic
1062429132 9:136519233-136519255 CTCGGGGGTCAGCACAGACAGGG - Intronic
1190941078 X:55041712-55041734 CTCTGGGGCAGCCACAGTAGGGG + Intergenic
1191758791 X:64624603-64624625 CTCTGGGGCAGCCACAGGAAGGG - Intergenic