ID: 953695185

View in Genome Browser
Species Human (GRCh38)
Location 3:45152723-45152745
Sequence TTGTATAAGGGGAAGTTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953695178_953695185 7 Left 953695178 3:45152693-45152715 CCAAAATGCCCACAGCCAATCAA No data
Right 953695185 3:45152723-45152745 TTGTATAAGGGGAAGTTTGATGG No data
953695180_953695185 -2 Left 953695180 3:45152702-45152724 CCACAGCCAATCAATGCTACATT No data
Right 953695185 3:45152723-45152745 TTGTATAAGGGGAAGTTTGATGG No data
953695181_953695185 -8 Left 953695181 3:45152708-45152730 CCAATCAATGCTACATTGTATAA No data
Right 953695185 3:45152723-45152745 TTGTATAAGGGGAAGTTTGATGG No data
953695177_953695185 8 Left 953695177 3:45152692-45152714 CCCAAAATGCCCACAGCCAATCA No data
Right 953695185 3:45152723-45152745 TTGTATAAGGGGAAGTTTGATGG No data
953695176_953695185 14 Left 953695176 3:45152686-45152708 CCTGATCCCAAAATGCCCACAGC No data
Right 953695185 3:45152723-45152745 TTGTATAAGGGGAAGTTTGATGG No data
953695175_953695185 21 Left 953695175 3:45152679-45152701 CCTTTAGCCTGATCCCAAAATGC No data
Right 953695185 3:45152723-45152745 TTGTATAAGGGGAAGTTTGATGG No data
953695174_953695185 22 Left 953695174 3:45152678-45152700 CCCTTTAGCCTGATCCCAAAATG No data
Right 953695185 3:45152723-45152745 TTGTATAAGGGGAAGTTTGATGG No data
953695179_953695185 -1 Left 953695179 3:45152701-45152723 CCCACAGCCAATCAATGCTACAT No data
Right 953695185 3:45152723-45152745 TTGTATAAGGGGAAGTTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953695185 Original CRISPR TTGTATAAGGGGAAGTTTGA TGG Intergenic
No off target data available for this crispr