ID: 953695923

View in Genome Browser
Species Human (GRCh38)
Location 3:45159133-45159155
Sequence GAGGGTGAAGAATGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953695923_953695929 -10 Left 953695923 3:45159133-45159155 CCCTCCTCCCATTCTTCACCCTC No data
Right 953695929 3:45159146-45159168 CTTCACCCTCAAGTAGGCCCTGG 0: 16
1: 144
2: 335
3: 434
4: 529
953695923_953695932 -4 Left 953695923 3:45159133-45159155 CCCTCCTCCCATTCTTCACCCTC No data
Right 953695932 3:45159152-45159174 CCTCAAGTAGGCCCTGGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953695923 Original CRISPR GAGGGTGAAGAATGGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr