ID: 953699325

View in Genome Browser
Species Human (GRCh38)
Location 3:45183841-45183863
Sequence CAGTCTCAGCAAGGTGACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953699321_953699325 18 Left 953699321 3:45183800-45183822 CCTTCTTTTTTATTTCCCAGCAT No data
Right 953699325 3:45183841-45183863 CAGTCTCAGCAAGGTGACATAGG No data
953699322_953699325 3 Left 953699322 3:45183815-45183837 CCCAGCATCTTTAAGCAGCTGCT No data
Right 953699325 3:45183841-45183863 CAGTCTCAGCAAGGTGACATAGG No data
953699323_953699325 2 Left 953699323 3:45183816-45183838 CCAGCATCTTTAAGCAGCTGCTC No data
Right 953699325 3:45183841-45183863 CAGTCTCAGCAAGGTGACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953699325 Original CRISPR CAGTCTCAGCAAGGTGACAT AGG Intergenic
No off target data available for this crispr