ID: 953703397

View in Genome Browser
Species Human (GRCh38)
Location 3:45213634-45213656
Sequence GCTGGGACTCTCCATTTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953703391_953703397 -6 Left 953703391 3:45213617-45213639 CCCCAGCCCTACGCGGTGCTGGG No data
Right 953703397 3:45213634-45213656 GCTGGGACTCTCCATTTCAGTGG No data
953703394_953703397 -8 Left 953703394 3:45213619-45213641 CCAGCCCTACGCGGTGCTGGGAC No data
Right 953703397 3:45213634-45213656 GCTGGGACTCTCCATTTCAGTGG No data
953703386_953703397 18 Left 953703386 3:45213593-45213615 CCAGTGCAGCGGCAGAGCCTGTG No data
Right 953703397 3:45213634-45213656 GCTGGGACTCTCCATTTCAGTGG No data
953703383_953703397 25 Left 953703383 3:45213586-45213608 CCTTGCCCCAGTGCAGCGGCAGA No data
Right 953703397 3:45213634-45213656 GCTGGGACTCTCCATTTCAGTGG No data
953703388_953703397 1 Left 953703388 3:45213610-45213632 CCTGTGGCCCCAGCCCTACGCGG No data
Right 953703397 3:45213634-45213656 GCTGGGACTCTCCATTTCAGTGG No data
953703393_953703397 -7 Left 953703393 3:45213618-45213640 CCCAGCCCTACGCGGTGCTGGGA No data
Right 953703397 3:45213634-45213656 GCTGGGACTCTCCATTTCAGTGG No data
953703384_953703397 20 Left 953703384 3:45213591-45213613 CCCCAGTGCAGCGGCAGAGCCTG No data
Right 953703397 3:45213634-45213656 GCTGGGACTCTCCATTTCAGTGG No data
953703385_953703397 19 Left 953703385 3:45213592-45213614 CCCAGTGCAGCGGCAGAGCCTGT No data
Right 953703397 3:45213634-45213656 GCTGGGACTCTCCATTTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953703397 Original CRISPR GCTGGGACTCTCCATTTCAG TGG Intergenic
No off target data available for this crispr