ID: 953704161

View in Genome Browser
Species Human (GRCh38)
Location 3:45218854-45218876
Sequence CAAGGTTATTTTGAGGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953704161_953704172 2 Left 953704161 3:45218854-45218876 CCACCCTCCTCAAAATAACCTTG No data
Right 953704172 3:45218879-45218901 CCTTGTCCCATCCCGGGGTGTGG No data
953704161_953704170 -3 Left 953704161 3:45218854-45218876 CCACCCTCCTCAAAATAACCTTG No data
Right 953704170 3:45218874-45218896 TTGGGCCTTGTCCCATCCCGGGG No data
953704161_953704169 -4 Left 953704161 3:45218854-45218876 CCACCCTCCTCAAAATAACCTTG No data
Right 953704169 3:45218873-45218895 CTTGGGCCTTGTCCCATCCCGGG No data
953704161_953704168 -5 Left 953704161 3:45218854-45218876 CCACCCTCCTCAAAATAACCTTG No data
Right 953704168 3:45218872-45218894 CCTTGGGCCTTGTCCCATCCCGG No data
953704161_953704177 28 Left 953704161 3:45218854-45218876 CCACCCTCCTCAAAATAACCTTG No data
Right 953704177 3:45218905-45218927 AAAGCATCCAGTGTCAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953704161 Original CRISPR CAAGGTTATTTTGAGGAGGG TGG (reversed) Intergenic
No off target data available for this crispr