ID: 953704314

View in Genome Browser
Species Human (GRCh38)
Location 3:45219821-45219843
Sequence CCACACATGGTGAAGGGGTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953704303_953704314 12 Left 953704303 3:45219786-45219808 CCGTGTTCCAGTTTAAGGTTTGT No data
Right 953704314 3:45219821-45219843 CCACACATGGTGAAGGGGTTCGG No data
953704304_953704314 5 Left 953704304 3:45219793-45219815 CCAGTTTAAGGTTTGTTCCCCAG No data
Right 953704314 3:45219821-45219843 CCACACATGGTGAAGGGGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953704314 Original CRISPR CCACACATGGTGAAGGGGTT CGG Intergenic
No off target data available for this crispr