ID: 953705285

View in Genome Browser
Species Human (GRCh38)
Location 3:45226045-45226067
Sequence TACGCGCGCGAGGCCGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 74}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953705275_953705285 22 Left 953705275 3:45226000-45226022 CCAGGAGCGCGGCGAGCAGGGGC 0: 1
1: 1
2: 4
3: 27
4: 266
Right 953705285 3:45226045-45226067 TACGCGCGCGAGGCCGGCGGCGG 0: 1
1: 0
2: 0
3: 11
4: 74
953705280_953705285 -8 Left 953705280 3:45226030-45226052 CCTGCGGCGGGCGCCTACGCGCG 0: 1
1: 0
2: 0
3: 2
4: 53
Right 953705285 3:45226045-45226067 TACGCGCGCGAGGCCGGCGGCGG 0: 1
1: 0
2: 0
3: 11
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953705285 Original CRISPR TACGCGCGCGAGGCCGGCGG CGG Exonic
901641432 1:10694887-10694909 AGCGCGCGCGCGGCCGCCGGCGG - Intronic
905390977 1:37635043-37635065 TCCGAGCGCGGGGCTGGCGGAGG + Intergenic
923299714 1:232630046-232630068 TGCGCTCGGGCGGCCGGCGGGGG + Intergenic
923591836 1:235327340-235327362 TCCGAGCGAGAGGCCGGCCGGGG + Intronic
1083799999 11:65041212-65041234 AAGGCACGCGAGGCCGGCCGGGG - Exonic
1089209457 11:116790557-116790579 GAGGCGCGCGGGGCTGGCGGGGG + Exonic
1089515857 11:119030898-119030920 TGCGCAAGCGCGGCCGGCGGGGG + Exonic
1089520044 11:119057248-119057270 TACGCGCGCCGGGGCGGCGGGGG - Intergenic
1092256212 12:6928006-6928028 TAGGCGGGCGCGGGCGGCGGCGG + Intronic
1096127672 12:49131477-49131499 TGGGCGCGCGGGGCCGGAGGAGG - Intergenic
1101493950 12:105236124-105236146 GACGCGCGCGGGGCCGCCGCGGG - Intronic
1106304061 13:28494928-28494950 TCAGGGCGCGGGGCCGGCGGCGG - Exonic
1113737649 13:112689930-112689952 TGTGGGCGCGGGGCCGGCGGGGG + Intergenic
1113948822 13:114059935-114059957 AACGCGGGCAAGGCTGGCGGGGG + Intronic
1121879434 14:97486907-97486929 TGGGCGGGCGAGGCCGGGGGCGG + Intergenic
1122108725 14:99480684-99480706 TGCGCCCGCGCGGCCCGCGGGGG - Intronic
1122917356 14:104865280-104865302 CCCGCGCGCGAGGCCGCCGGCGG + Intronic
1122978752 14:105181685-105181707 TCCGCGGGCGGGGCCGGGGGCGG + Intergenic
1125626897 15:41116181-41116203 TGCGGGCGCTGGGCCGGCGGCGG + Exonic
1129780155 15:78264655-78264677 GACGCGCGAGCGGGCGGCGGGGG + Intronic
1130224400 15:82046250-82046272 GGCGCGCGCCAGGCCGGGGGCGG + Intergenic
1132568439 16:633759-633781 CACGCGGGCGATGCCGCCGGCGG - Exonic
1132585956 16:705833-705855 GGCGCGCGCGGCGCCGGCGGCGG - Intronic
1137645096 16:50066568-50066590 GACGCGGGGGAGGCCAGCGGTGG - Intronic
1139676949 16:68530293-68530315 TCCGCGCTCGGGGCTGGCGGCGG - Intronic
1147360561 17:39927288-39927310 TGCGAGCGGGAGGCCGGGGGTGG - Intronic
1148000668 17:44385379-44385401 GGCGCGCGCGAGCCCGGAGGAGG + Intronic
1149597889 17:57874842-57874864 TTCGGGCGGGTGGCCGGCGGCGG + Intronic
1149894885 17:60421847-60421869 TGCGCACACGAGGCCGGCGACGG + Intronic
1151719833 17:75848752-75848774 AACGCCCGGGAGGCCTGCGGGGG + Intronic
1151755860 17:76074914-76074936 AACGCGAGCCAGGCGGGCGGCGG + Exonic
1153688343 18:7567755-7567777 TGGGCGCGCGAGGGCGGAGGGGG - Exonic
1153886977 18:9475760-9475782 CGCGGGCGCGAGGCCGGCGCGGG - Intronic
1155910349 18:31498188-31498210 TGCGCGCTCGGGGCAGGCGGCGG + Exonic
1156275827 18:35581835-35581857 TAGGCGCGCGGCGGCGGCGGCGG - Intronic
1160937820 19:1605485-1605507 CACGCGCGCGGGGAGGGCGGGGG + Exonic
1160999951 19:1905565-1905587 GACGCGCGCGAGGCTGGCCTGGG - Intronic
1161015000 19:1979100-1979122 TGCGCGCGCGCGGCGGGGGGCGG + Intronic
1165080044 19:33301837-33301859 TGCGGGTGCGAGGGCGGCGGCGG + Exonic
1166882993 19:45940332-45940354 TACGCGGGCGAGGCCGGGGCCGG - Exonic
1167001207 19:46746519-46746541 ACCGCGCGCGCGCCCGGCGGGGG + Exonic
1167709038 19:51098911-51098933 TACGCGCCCGAGGCCTTCCGCGG - Exonic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
942565964 2:177264805-177264827 TCAGCCCGCGCGGCCGGCGGGGG - Exonic
945699393 2:213151668-213151690 TGCGCGAGCCCGGCCGGCGGGGG - Intronic
1172016696 20:31879828-31879850 TAAGCACGCGAGGCGCGCGGTGG + Intronic
1176194568 20:63831292-63831314 CGCGCGCGCGCGGGCGGCGGGGG - Intergenic
1178351139 21:31873665-31873687 GGCGAGCGCGATGCCGGCGGCGG + Exonic
1179989581 21:44940160-44940182 CCCGCGGCCGAGGCCGGCGGAGG - Exonic
1180614940 22:17120795-17120817 GACAGGCGCGGGGCCGGCGGGGG + Exonic
1180831093 22:18906486-18906508 TACGCGGGCGGGGCGGGCGGCGG + Intronic
1181068749 22:20319855-20319877 TACGCAGGCGGGGCGGGCGGAGG - Intronic
1183649445 22:39145655-39145677 TGCGTGCGCGCGGCCGGCGGGGG - Intronic
1184023076 22:41833674-41833696 TGGGCGCGCGAGGGAGGCGGCGG - Intronic
1184301129 22:43561669-43561691 CACTCGAGCGAGGCTGGCGGCGG - Intronic
1184361975 22:44024315-44024337 GCCGCGCGTGGGGCCGGCGGCGG - Intronic
1184712720 22:46262750-46262772 CACGCGCGCGGGGCCGTCTGTGG + Exonic
1203281180 22_KI270734v1_random:131757-131779 TACGCGGGCGGGGCGGGCGGCGG + Intergenic
950729783 3:14947601-14947623 TACCAGCGCGCGGGCGGCGGCGG + Intronic
953705285 3:45226045-45226067 TACGCGCGCGAGGCCGGCGGCGG + Exonic
966182194 3:177197548-177197570 TGAGCTCGCGAGGCCCGCGGCGG + Intergenic
967171795 3:186827569-186827591 TGCGCGAGCGCGGCGGGCGGAGG + Intergenic
967858287 3:194134373-194134395 TACGCCCGGGAGGCCGCCGGCGG - Intergenic
968225341 3:196969188-196969210 CACGCGCGGGAGGTCGGCGAGGG + Intergenic
984888696 4:184473364-184473386 CCAGCGCGCGAGGCCGGCCGGGG + Intronic
989812609 5:45695991-45696013 GACGGGCGCGGGGCCGGCCGCGG - Exonic
990699514 5:58460180-58460202 CACGCGCGCTCGGCCGGCCGTGG - Exonic
994367110 5:98928815-98928837 CGCGCGCGCGACGGCGGCGGCGG - Exonic
1002632685 5:180591545-180591567 AGCGCGGGCGAGGCCGGCGCTGG - Intergenic
1004561804 6:16759968-16759990 TGCGCGCGCGCGCCGGGCGGGGG - Intronic
1007327312 6:41072584-41072606 TACGCATGCGCGGGCGGCGGCGG - Exonic
1019343584 7:519517-519539 GGCGAGCGCGGGGCCGGCGGTGG - Intronic
1019563268 7:1668097-1668119 TACGCGCGCGGGGCCGTGGGAGG - Intergenic
1020461407 7:8433698-8433720 TCGGCGCTCGAGGCCGGCAGGGG + Intergenic
1025943419 7:66089331-66089353 TACAGGTGCGAGGCCGGGGGAGG + Exonic
1031025205 7:116672272-116672294 TCGGCGCGCGCGGCCCGCGGCGG - Intergenic
1033299935 7:140176664-140176686 GAGGCGCGGGCGGCCGGCGGCGG + Intronic
1033299972 7:140176822-140176844 TACACGGGCGGGGGCGGCGGAGG + Exonic
1039595453 8:38787130-38787152 CGCGCGCGCGGGGGCGGCGGCGG - Intronic
1049807554 8:144547812-144547834 TACGCGCCCAACCCCGGCGGTGG - Exonic
1054738466 9:68780209-68780231 TACGGGCGGGAGCCCGGCGGAGG + Exonic
1055611693 9:78031339-78031361 GACGCGCGCCCGGGCGGCGGGGG - Exonic
1055611831 9:78031764-78031786 TCTGCGCGCGAGCCGGGCGGTGG - Intergenic
1056732537 9:89178331-89178353 GGCGCGCGCGACCCCGGCGGCGG - Exonic
1058058546 9:100473235-100473257 GGCGCGCGCGCGGCGGGCGGGGG - Exonic
1189336777 X:40175265-40175287 TACGCGCGCGGGGCCAGCCGGGG - Intronic