ID: 953707118

View in Genome Browser
Species Human (GRCh38)
Location 3:45239732-45239754
Sequence GTGCTTTCTGGAACCCTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953707118_953707127 22 Left 953707118 3:45239732-45239754 CCTTGGAGGGTTCCAGAAAGCAC No data
Right 953707127 3:45239777-45239799 GTTTCTGATTCAGCACATCTGGG No data
953707118_953707126 21 Left 953707118 3:45239732-45239754 CCTTGGAGGGTTCCAGAAAGCAC No data
Right 953707126 3:45239776-45239798 CGTTTCTGATTCAGCACATCTGG No data
953707118_953707129 26 Left 953707118 3:45239732-45239754 CCTTGGAGGGTTCCAGAAAGCAC No data
Right 953707129 3:45239781-45239803 CTGATTCAGCACATCTGGGTGGG No data
953707118_953707128 25 Left 953707118 3:45239732-45239754 CCTTGGAGGGTTCCAGAAAGCAC No data
Right 953707128 3:45239780-45239802 TCTGATTCAGCACATCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953707118 Original CRISPR GTGCTTTCTGGAACCCTCCA AGG (reversed) Intergenic
No off target data available for this crispr