ID: 953707122

View in Genome Browser
Species Human (GRCh38)
Location 3:45239744-45239766
Sequence CGCCCAGCACCTGTGCTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953707122_953707127 10 Left 953707122 3:45239744-45239766 CCAGAAAGCACAGGTGCTGGGCG No data
Right 953707127 3:45239777-45239799 GTTTCTGATTCAGCACATCTGGG No data
953707122_953707128 13 Left 953707122 3:45239744-45239766 CCAGAAAGCACAGGTGCTGGGCG No data
Right 953707128 3:45239780-45239802 TCTGATTCAGCACATCTGGGTGG No data
953707122_953707129 14 Left 953707122 3:45239744-45239766 CCAGAAAGCACAGGTGCTGGGCG No data
Right 953707129 3:45239781-45239803 CTGATTCAGCACATCTGGGTGGG No data
953707122_953707126 9 Left 953707122 3:45239744-45239766 CCAGAAAGCACAGGTGCTGGGCG No data
Right 953707126 3:45239776-45239798 CGTTTCTGATTCAGCACATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953707122 Original CRISPR CGCCCAGCACCTGTGCTTTC TGG (reversed) Intergenic
No off target data available for this crispr