ID: 953707129

View in Genome Browser
Species Human (GRCh38)
Location 3:45239781-45239803
Sequence CTGATTCAGCACATCTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953707118_953707129 26 Left 953707118 3:45239732-45239754 CCTTGGAGGGTTCCAGAAAGCAC No data
Right 953707129 3:45239781-45239803 CTGATTCAGCACATCTGGGTGGG No data
953707122_953707129 14 Left 953707122 3:45239744-45239766 CCAGAAAGCACAGGTGCTGGGCG No data
Right 953707129 3:45239781-45239803 CTGATTCAGCACATCTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953707129 Original CRISPR CTGATTCAGCACATCTGGGT GGG Intergenic
No off target data available for this crispr