ID: 953707129 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:45239781-45239803 |
| Sequence | CTGATTCAGCACATCTGGGT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 953707118_953707129 | 26 | Left | 953707118 | 3:45239732-45239754 | CCTTGGAGGGTTCCAGAAAGCAC | No data | ||
| Right | 953707129 | 3:45239781-45239803 | CTGATTCAGCACATCTGGGTGGG | No data | ||||
| 953707122_953707129 | 14 | Left | 953707122 | 3:45239744-45239766 | CCAGAAAGCACAGGTGCTGGGCG | No data | ||
| Right | 953707129 | 3:45239781-45239803 | CTGATTCAGCACATCTGGGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 953707129 | Original CRISPR | CTGATTCAGCACATCTGGGT GGG | Intergenic | ||
| No off target data available for this crispr | |||||