ID: 953707335

View in Genome Browser
Species Human (GRCh38)
Location 3:45241137-45241159
Sequence ATTCCCACCAATACTATAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953707335_953707340 18 Left 953707335 3:45241137-45241159 CCTGCTATAGTATTGGTGGGAAT No data
Right 953707340 3:45241178-45241200 GTTTCCCCAGATTCTATAGTCGG No data
953707335_953707345 30 Left 953707335 3:45241137-45241159 CCTGCTATAGTATTGGTGGGAAT No data
Right 953707345 3:45241190-45241212 TCTATAGTCGGACTGGTCCCAGG No data
953707335_953707343 23 Left 953707335 3:45241137-45241159 CCTGCTATAGTATTGGTGGGAAT No data
Right 953707343 3:45241183-45241205 CCCAGATTCTATAGTCGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953707335 Original CRISPR ATTCCCACCAATACTATAGC AGG (reversed) Intergenic
No off target data available for this crispr