ID: 953707336

View in Genome Browser
Species Human (GRCh38)
Location 3:45241141-45241163
Sequence CTATAGTATTGGTGGGAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953707328_953707336 14 Left 953707328 3:45241104-45241126 CCTCCTTGGAGCCAGCTGTGGGA No data
Right 953707336 3:45241141-45241163 CTATAGTATTGGTGGGAATTTGG No data
953707329_953707336 11 Left 953707329 3:45241107-45241129 CCTTGGAGCCAGCTGTGGGACTT No data
Right 953707336 3:45241141-45241163 CTATAGTATTGGTGGGAATTTGG No data
953707330_953707336 3 Left 953707330 3:45241115-45241137 CCAGCTGTGGGACTTGCCATTGC No data
Right 953707336 3:45241141-45241163 CTATAGTATTGGTGGGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953707336 Original CRISPR CTATAGTATTGGTGGGAATT TGG Intergenic
No off target data available for this crispr