ID: 953707343

View in Genome Browser
Species Human (GRCh38)
Location 3:45241183-45241205
Sequence CCCAGATTCTATAGTCGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953707332_953707343 29 Left 953707332 3:45241131-45241153 CCATTGCCTGCTATAGTATTGGT No data
Right 953707343 3:45241183-45241205 CCCAGATTCTATAGTCGGACTGG No data
953707335_953707343 23 Left 953707335 3:45241137-45241159 CCTGCTATAGTATTGGTGGGAAT No data
Right 953707343 3:45241183-45241205 CCCAGATTCTATAGTCGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953707343 Original CRISPR CCCAGATTCTATAGTCGGAC TGG Intergenic
No off target data available for this crispr