ID: 953707345

View in Genome Browser
Species Human (GRCh38)
Location 3:45241190-45241212
Sequence TCTATAGTCGGACTGGTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953707335_953707345 30 Left 953707335 3:45241137-45241159 CCTGCTATAGTATTGGTGGGAAT No data
Right 953707345 3:45241190-45241212 TCTATAGTCGGACTGGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953707345 Original CRISPR TCTATAGTCGGACTGGTCCC AGG Intergenic
No off target data available for this crispr