ID: 953718178

View in Genome Browser
Species Human (GRCh38)
Location 3:45333535-45333557
Sequence CTGTGCAGATGGAAGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953718171_953718178 6 Left 953718171 3:45333506-45333528 CCATGAATCCTACTTACCGCACT No data
Right 953718178 3:45333535-45333557 CTGTGCAGATGGAAGGAAGTGGG No data
953718173_953718178 -2 Left 953718173 3:45333514-45333536 CCTACTTACCGCACTGGAGAGCT No data
Right 953718178 3:45333535-45333557 CTGTGCAGATGGAAGGAAGTGGG No data
953718170_953718178 19 Left 953718170 3:45333493-45333515 CCTACAGGGACTACCATGAATCC No data
Right 953718178 3:45333535-45333557 CTGTGCAGATGGAAGGAAGTGGG No data
953718174_953718178 -10 Left 953718174 3:45333522-45333544 CCGCACTGGAGAGCTGTGCAGAT No data
Right 953718178 3:45333535-45333557 CTGTGCAGATGGAAGGAAGTGGG No data
953718169_953718178 30 Left 953718169 3:45333482-45333504 CCTTCTTCTATCCTACAGGGACT No data
Right 953718178 3:45333535-45333557 CTGTGCAGATGGAAGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953718178 Original CRISPR CTGTGCAGATGGAAGGAAGT GGG Intergenic
No off target data available for this crispr