ID: 953719391

View in Genome Browser
Species Human (GRCh38)
Location 3:45342050-45342072
Sequence CTGGTGGCACACTGGTGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953719384_953719391 17 Left 953719384 3:45342010-45342032 CCATTCACTCATCAGAACTGCTC No data
Right 953719391 3:45342050-45342072 CTGGTGGCACACTGGTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953719391 Original CRISPR CTGGTGGCACACTGGTGGCT GGG Intergenic
No off target data available for this crispr