ID: 953720794

View in Genome Browser
Species Human (GRCh38)
Location 3:45353298-45353320
Sequence GCAAAAGAGTGATGAGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953720794_953720798 4 Left 953720794 3:45353298-45353320 CCTGTTTCTCATCACTCTTTTGC No data
Right 953720798 3:45353325-45353347 CCAGAGCTGTAGCCATCTGAAGG No data
953720794_953720799 13 Left 953720794 3:45353298-45353320 CCTGTTTCTCATCACTCTTTTGC No data
Right 953720799 3:45353334-45353356 TAGCCATCTGAAGGCTTGACTGG No data
953720794_953720800 14 Left 953720794 3:45353298-45353320 CCTGTTTCTCATCACTCTTTTGC No data
Right 953720800 3:45353335-45353357 AGCCATCTGAAGGCTTGACTGGG 0: 10
1: 91
2: 232
3: 393
4: 706
953720794_953720802 22 Left 953720794 3:45353298-45353320 CCTGTTTCTCATCACTCTTTTGC No data
Right 953720802 3:45353343-45353365 GAAGGCTTGACTGGGACTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953720794 Original CRISPR GCAAAAGAGTGATGAGAAAC AGG (reversed) Intergenic
No off target data available for this crispr