ID: 953727234

View in Genome Browser
Species Human (GRCh38)
Location 3:45410671-45410693
Sequence CTCAGACATTTCTACAAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 179}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953727230_953727234 20 Left 953727230 3:45410628-45410650 CCATTTCCTATTTCTGCTTCTCT 0: 1
1: 2
2: 14
3: 180
4: 1482
Right 953727234 3:45410671-45410693 CTCAGACATTTCTACAAGCTAGG 0: 1
1: 0
2: 1
3: 14
4: 179
953727233_953727234 -10 Left 953727233 3:45410658-45410680 CCAGCTTTATTTTCTCAGACATT 0: 1
1: 0
2: 2
3: 40
4: 428
Right 953727234 3:45410671-45410693 CTCAGACATTTCTACAAGCTAGG 0: 1
1: 0
2: 1
3: 14
4: 179
953727231_953727234 14 Left 953727231 3:45410634-45410656 CCTATTTCTGCTTCTCTCCACAT 0: 1
1: 0
2: 2
3: 56
4: 812
Right 953727234 3:45410671-45410693 CTCAGACATTTCTACAAGCTAGG 0: 1
1: 0
2: 1
3: 14
4: 179
953727232_953727234 -3 Left 953727232 3:45410651-45410673 CCACATGCCAGCTTTATTTTCTC 0: 1
1: 0
2: 5
3: 42
4: 385
Right 953727234 3:45410671-45410693 CTCAGACATTTCTACAAGCTAGG 0: 1
1: 0
2: 1
3: 14
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953727234 Original CRISPR CTCAGACATTTCTACAAGCT AGG Intronic
900011547 1:114978-115000 TTCAGAAATTCCTATAAGCTTGG + Intergenic
900027650 1:291542-291564 TTCAGAAATTCCTATAAGCTTGG + Intergenic
900041607 1:470984-471006 TTCAGAAATTCCTATAAGCTTGG + Intergenic
900063042 1:705961-705983 TTCAGAAATTCCTATAAGCTTGG + Intergenic
905595681 1:39204635-39204657 CTCAGACCCTTCTACAAGAAGGG - Intronic
907938671 1:59066079-59066101 CCCAGACATGCCAACAAGCTGGG - Intergenic
908158839 1:61386062-61386084 CTAAGACATTTTTAAAAGGTTGG + Intronic
910518848 1:88094592-88094614 CTGAGACCTTTCTTCATGCTGGG + Intergenic
910524251 1:88159395-88159417 ATAAGACATTTCTACAAGTTTGG - Intergenic
910718427 1:90257905-90257927 CTAAGACATTTCTGGAAGATAGG + Intergenic
911246296 1:95522074-95522096 CTCTGACATTTCTGGATGCTGGG + Intergenic
913048609 1:115095328-115095350 CCAAGAGATTTCTACAACCTGGG + Intergenic
914746486 1:150505165-150505187 TTCATACATCTCTACAAGGTAGG - Intronic
915841489 1:159216795-159216817 CACAGACATTTCTCCAAGAGGGG + Intergenic
917180301 1:172288933-172288955 CCCAGGCATTACTACCAGCTAGG - Intronic
918276659 1:182959393-182959415 CTCAGGCTGTTCTCCAAGCTAGG + Intergenic
920113898 1:203606335-203606357 CTGAGTAATTTCTACAAGCTAGG - Intergenic
921107350 1:211995906-211995928 TTCGGACATTTCTGGAAGCTGGG - Intronic
922259986 1:223930986-223931008 TTCAGAAATTCCTATAAGCTTGG + Intergenic
922876091 1:228940829-228940851 CTGAGACTTTTCTTCAGGCTGGG + Intergenic
924341150 1:243033545-243033567 TTCAGAAATTCCTATAAGCTTGG + Intergenic
1063261673 10:4396234-4396256 CTCATAGATTTCTGCAATCTCGG - Intergenic
1064502041 10:15984265-15984287 GTCAGGCATTTCTACACACTTGG + Intergenic
1065692311 10:28347215-28347237 CTCACACAGTTCTGCAGGCTGGG + Intergenic
1066222613 10:33350408-33350430 CTGAAACATTTTTGCAAGCTTGG - Intergenic
1066735319 10:38471862-38471884 TTCAGAAATTCCTATAAGCTTGG - Intergenic
1067736722 10:48860328-48860350 TTCTGACAGTTCTACAGGCTGGG + Intronic
1068099297 10:52532040-52532062 CTCAGACATTTTTCCATGGTAGG - Intergenic
1068348362 10:55813357-55813379 GTCAGACATCTCTACACTCTTGG + Intergenic
1069949928 10:72011718-72011740 CTGAGCCATTTCTATATGCTGGG - Exonic
1072552139 10:96487179-96487201 CTCACACACTTCTACCAGGTAGG - Intronic
1076102015 10:127790035-127790057 CTTAGCCATTTCTATAAGCTAGG + Intergenic
1076967882 11:107212-107234 TTCAGAAATTCCTATAAGCTTGG + Intergenic
1077716165 11:4582666-4582688 CTCAGACAATCCTACCACCTCGG + Intergenic
1079273532 11:19012178-19012200 ATAAGACAATTCTAAAAGCTTGG - Intergenic
1080174480 11:29345351-29345373 TTCATACATTTCTGCAGGCTAGG - Intergenic
1080438690 11:32270378-32270400 CTCACATATTTCTGCCAGCTGGG + Intergenic
1084062793 11:66686994-66687016 CGCAAACATGTCTTCAAGCTGGG - Exonic
1084113640 11:67029206-67029228 CTCAGTCATTCCTAAAAGCTGGG + Intronic
1084290560 11:68163211-68163233 CTCAGCAATTACTACATGCTAGG + Intronic
1087934548 11:104017213-104017235 TTCTCACATTTCTACAGGCTGGG - Intronic
1088732132 11:112693052-112693074 CTCTCACATTTCTGCCAGCTTGG + Intergenic
1088732477 11:112695477-112695499 CTCTCACATTTCTACCAGATTGG + Intergenic
1089391371 11:118104285-118104307 CTCAGACATTTCCCCAGGCTGGG + Intronic
1093389735 12:18603416-18603438 AGAAGACATTTCTAAAAGCTTGG + Intronic
1093596661 12:20970513-20970535 GGCAGACATTTCCACCAGCTTGG - Intergenic
1093930455 12:24950334-24950356 CTGAGTGATTTCTACATGCTAGG + Intergenic
1095493176 12:42757528-42757550 CTCAGACATTTCTAATGACTGGG + Intergenic
1098283310 12:68883444-68883466 CCCAGACATTGCCACGAGCTGGG + Intronic
1098508456 12:71282757-71282779 CCCAGACATCTCTGCAATCTCGG - Exonic
1098731466 12:74040717-74040739 CTGAGACATTTTTCCCAGCTGGG + Intergenic
1102767631 12:115447545-115447567 CTAAGAAATTTCTTCATGCTAGG - Intergenic
1104697353 12:130872936-130872958 CTCACATATTTCCACAAGCAAGG - Intronic
1104770668 12:131361899-131361921 CTCACACATTGCTGCAGGCTTGG - Intergenic
1104928284 12:132324999-132325021 CACAGCCATGTCTGCAAGCTGGG - Intronic
1105929254 13:25036875-25036897 CTCTGACAGTTCTAAAGGCTGGG + Intergenic
1106977470 13:35237377-35237399 GACATACATTTCTACAGGCTGGG - Intronic
1107596988 13:41973406-41973428 CACAGCCATTTCCCCAAGCTCGG - Intergenic
1110517340 13:76430028-76430050 CTCAGACATTTATACAAGTTTGG - Intergenic
1112066108 13:95794905-95794927 CTCAGACATGTCTACAAATATGG + Exonic
1113391891 13:109905741-109905763 CTCTTGCATTTTTACAAGCTGGG + Intergenic
1115656197 14:35445974-35445996 CTGAGACATCTCTACCAACTGGG - Intergenic
1116732133 14:48637202-48637224 ATAAGACAATTCTAAAAGCTTGG + Intergenic
1117043832 14:51792282-51792304 CTCAGACATTTTCACACCCTGGG - Intergenic
1119414120 14:74458091-74458113 CTCAGAAATTGTTCCAAGCTGGG - Intergenic
1119926504 14:78499528-78499550 TTAACACATTTCCACAAGCTTGG + Intronic
1124557274 15:30737506-30737528 ATAAGAGATTTCTAAAAGCTTGG + Intronic
1124673991 15:31668243-31668265 ATAAGAGATTTCTAAAAGCTTGG - Intronic
1125318852 15:38460092-38460114 GTCAGACACTACTTCAAGCTGGG - Intronic
1126431887 15:48594509-48594531 CTCAGAGGTTTCTCCAAGTTTGG - Intronic
1128699683 15:69795129-69795151 CTCAGACCTCACTACTAGCTAGG - Intergenic
1130401776 15:83562839-83562861 CTTAAACATTTCAACAATCTTGG + Intronic
1131059461 15:89395684-89395706 CTCAGACACTTTGACAGGCTGGG - Intergenic
1137964784 16:52920010-52920032 CTCAGACATATCTTCTAGATGGG + Intergenic
1139903521 16:70346719-70346741 CTCAGACATTTTAAGAAGCGAGG + Intronic
1139944243 16:70628046-70628068 CTCAGACATTTCTGGAAGGAAGG - Intronic
1140327747 16:74022283-74022305 CTCAGACAGTTCTTCCACCTTGG - Intergenic
1142452798 16:90191927-90191949 TTCAGAAATTCCTATAAGCTTGG - Intergenic
1145744993 17:27311149-27311171 CCAAGACATTTTTAAAAGCTAGG - Intronic
1150221060 17:63496204-63496226 CTCAGACAATGCTAAGAGCTGGG + Intronic
1160644687 19:176835-176857 TTCAGAAATTCCTATAAGCTTGG + Intergenic
925339095 2:3122629-3122651 CACAGACATTTTCACAGGCTGGG + Intergenic
928216221 2:29363502-29363524 CTGAGACATGTCTTCTAGCTGGG + Intronic
929698782 2:44143479-44143501 CTCAAACATATTTTCAAGCTTGG + Intergenic
932323216 2:70837198-70837220 CTCAGACATTTACACAGTCTGGG + Intergenic
933468563 2:82689452-82689474 CTCATACATTTTTACATACTGGG - Intergenic
934637784 2:96006884-96006906 TGAAGACATTTCTACCAGCTAGG + Intergenic
934795877 2:97098527-97098549 TGAAGACATTTCTACCAGCTAGG - Intergenic
935062253 2:99618978-99619000 CTCAAACAGTTCTCCCAGCTTGG + Intronic
939314173 2:140525960-140525982 TGCACACATTTCTATAAGCTTGG - Exonic
939904410 2:147893088-147893110 CTCAGAGATTGCCAGAAGCTGGG - Intronic
941608937 2:167636362-167636384 CTCAGACACTTCTACACTGTTGG + Intergenic
943341760 2:186690853-186690875 ATGAGAAAATTCTACAAGCTTGG + Intergenic
945263997 2:207872235-207872257 ATCTTACATTTCTACAAGGTGGG - Intronic
947776558 2:232716493-232716515 CTCAGTCATCCCTACTAGCTGGG + Intronic
948437315 2:237962327-237962349 CTCAGACATCTCCACAATCCAGG - Intergenic
949084239 2:242136588-242136610 TTCAGAAATTCCTATAAGCTTGG - Intergenic
1170494914 20:16915164-16915186 CCCAGGCATTTCTGCATGCTTGG + Intergenic
1171342235 20:24439475-24439497 CACAGCCATTGCTACAAGATGGG + Intergenic
1172525135 20:35596153-35596175 CTCAGACGTCTCCACCAGCTTGG + Intergenic
1173612788 20:44382871-44382893 TTCAAACATTTCTCCAGGCTGGG + Intronic
1174541920 20:51296492-51296514 CTCAGACATGTCTAAGAACTGGG + Intergenic
1176280822 20:64309072-64309094 TTCAGAAATTCCTATAAGCTTGG - Intergenic
1182018527 22:27061309-27061331 CTAAGACCTTTCAACATGCTAGG + Intergenic
1184789892 22:46693797-46693819 CTCAGTCATTTCTCCCAGCCAGG - Intronic
950165551 3:10794739-10794761 CCCAGGCCTTTCTACAATCTTGG + Intergenic
950369907 3:12520408-12520430 GTCAGACATTTCTAAAAGCGTGG - Intronic
950403286 3:12787700-12787722 CTCAGGCTGTTCTCCAAGCTGGG + Intergenic
953727234 3:45410671-45410693 CTCAGACATTTCTACAAGCTAGG + Intronic
954649025 3:52148837-52148859 TTAAGACAGTTCTGCAAGCTAGG - Intronic
955558686 3:60165045-60165067 CCCAGACATTTTCACAAGCCAGG + Intronic
961707048 3:128795280-128795302 CTCAGACATTTGTGCAAGGGAGG + Intronic
963329104 3:143894413-143894435 CTCAGACATTCCTAGCTGCTTGG - Intergenic
963418799 3:145032694-145032716 CTCTTACATTTCTCAAAGCTTGG - Intergenic
964625148 3:158751551-158751573 ATCAGACAATTCTACCAGCCAGG - Intronic
966834765 3:184040648-184040670 CTCACAGATTTCTAAAAGGTGGG + Intergenic
969044336 4:4325835-4325857 CTCAGACATTTTGAGATGCTGGG - Intergenic
970881707 4:20939885-20939907 TTCAGACATTGCTAAAAGCTTGG - Intronic
971047342 4:22819778-22819800 CTCAGACATTTCAACTACCGGGG - Intergenic
974979260 4:68933751-68933773 CTCAGAAATTACTACAGGTTTGG + Intronic
975040961 4:69743889-69743911 CCCAGGCATTTCTGCAATCTAGG - Intronic
975190858 4:71460455-71460477 CTCAAACTTTTCTTCAAGCAGGG + Intronic
979118642 4:116863303-116863325 CTAAAACATTTCAACAAGGTTGG - Intergenic
979261674 4:118654826-118654848 TTCAGAAATTCCTATAAGCTTGG - Intergenic
980026718 4:127776740-127776762 CTGAAACACTTCTACAACCTAGG + Intergenic
982060471 4:151599547-151599569 CTCAGACTTTTCAACAGTCTAGG - Intronic
982141989 4:152332224-152332246 GCCAGACATTTCTTCAAGGTGGG - Intronic
983150157 4:164268501-164268523 TTCAGAAATTCCTATAAGCTTGG + Intronic
984600942 4:181726297-181726319 CTCTGACATTTCTACATGGTAGG - Intergenic
984739778 4:183149902-183149924 CTCAAACATTTCTATAAACTGGG + Intronic
986453990 5:7897072-7897094 CTCAGACATTTCCTTAAGCATGG + Exonic
987639194 5:20589716-20589738 CCCACTCATTTCTAGAAGCTGGG - Intergenic
988202028 5:28080990-28081012 CTCAGACTGTTTTACAAGGTAGG + Intergenic
988947460 5:36220434-36220456 CTCAGCCTTTTCTTCAAGATTGG - Intronic
990534599 5:56707857-56707879 CTCATACATTTCTACTATCAAGG - Intergenic
992073749 5:73172581-73172603 CTCTGCCATTTCTACAAAGTTGG + Intergenic
994744943 5:103666527-103666549 CTCAGACACTTCCTCTAGCTAGG + Intergenic
995051320 5:107708030-107708052 CTCAGTCATTTTTACAAATTAGG - Intergenic
995817960 5:116192709-116192731 AGAAGAGATTTCTACAAGCTTGG + Intronic
999513154 5:152273758-152273780 CTCAGAGATTTCTACAAACCAGG + Intergenic
1002560916 5:180081482-180081504 CTCAGACATGTCTTCCAGGTAGG + Intergenic
1002732237 5:181347945-181347967 TTCAGAAATTCCTATAAGCTTGG - Intergenic
1002752299 6:126160-126182 TTCAGAAATTCCTATAAGCTTGG + Intergenic
1003356340 6:5376022-5376044 ATGAGACATTTCTACGTGCTGGG + Intronic
1004093910 6:12533780-12533802 CTCAGACAGATCTGCAAGATTGG - Intergenic
1008652266 6:53575530-53575552 TTATGACATTTCTACAGGCTAGG - Intronic
1009891444 6:69688600-69688622 CTCATACTTTTCAACAAACTGGG + Intronic
1009985193 6:70773723-70773745 TTCATACATTTCTAGAATCTAGG - Intronic
1015698722 6:136011043-136011065 CTCAGACATAGACACAAGCTGGG + Intronic
1016891534 6:149012302-149012324 CTCAGATTTTTTTACAAGGTTGG + Intronic
1018610499 6:165643466-165643488 CCCAGAGATTTTTACATGCTGGG + Intronic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1019236489 6:170620260-170620282 TTCAGAAATTCCTATAAGCTTGG - Intergenic
1020920429 7:14257311-14257333 CACAGACATTTTTATTAGCTTGG + Intronic
1022170898 7:27829083-27829105 TTCAGACAGTTCTGCAAACTAGG - Exonic
1023064709 7:36366183-36366205 CGCAAACATTTCTGCAAGCAGGG - Intronic
1023181030 7:37484021-37484043 ATCAGACATTTCTACAGTTTAGG + Intergenic
1025636702 7:63326712-63326734 CTCAAACTTTTCCCCAAGCTTGG - Intergenic
1025645994 7:63421390-63421412 CTCAAACTTTTCCCCAAGCTTGG + Intergenic
1025994160 7:66517783-66517805 CTCAGACCTTTCCAGAAGCTTGG + Intergenic
1026767886 7:73171950-73171972 CTCAGACAATTCTCCTACCTTGG + Intergenic
1026985775 7:74554482-74554504 CTCAGACCTTTCCAGAAGCTTGG + Intronic
1027044354 7:74981658-74981680 CTCAGACAATTCTCCTACCTTGG + Intronic
1027079287 7:75220700-75220722 CTCAGACAATTCTCCTACCTTGG - Intergenic
1029388516 7:100259281-100259303 CTCAGACAATTCTCCTACCTTGG - Intronic
1030570190 7:111213086-111213108 CCCAGGCATTTCTACACTCTTGG + Intronic
1034010266 7:147521984-147522006 TTCTGACAGTTCTAGAAGCTGGG + Intronic
1035511281 8:186348-186370 TTCAGAAATTCCTATAAGCTTGG + Intergenic
1036307777 8:7614386-7614408 CTCAAACATTTATACAAGTGTGG - Intergenic
1036358631 8:8062387-8062409 CTCAAACATTTATACAAGTGTGG - Intergenic
1036899872 8:12662541-12662563 CTCAAACATTTCCACAAGTGTGG + Intergenic
1041569059 8:59315202-59315224 CTCACACATTTTTAAAAGTTAGG - Intergenic
1044525055 8:93242040-93242062 CCCAGGCATCTCTACAATCTTGG - Intergenic
1044937455 8:97306861-97306883 CTTAGACATTTCTAGAGGCGAGG + Intergenic
1045796638 8:106053233-106053255 CTCTGACAGTTCTAAAACCTGGG - Intergenic
1045820777 8:106335506-106335528 CTCAGACATTTCTCCATGGAAGG + Intronic
1046680205 8:117160547-117160569 TGCAGACATTTGTAAAAGCTTGG - Intronic
1046844473 8:118900503-118900525 CTCAGACATATCTAAGAGCCTGG - Intergenic
1047314921 8:123723985-123724007 CTCTGACATTAATACAAACTGGG - Intronic
1050014876 9:1223061-1223083 CTCTGAACTTTCTACAAGATGGG + Intergenic
1052398617 9:27972650-27972672 CTCAGAAATTTCTACCTGCGTGG - Intronic
1057641735 9:96830335-96830357 CTGAGACATGTCTCCAAGCCAGG + Intronic
1059534271 9:115066528-115066550 CTCAGACATTTCTAAGTTCTGGG + Intronic
1062756639 9:138300271-138300293 TTCAGAAATTCCTATAAGCTTGG - Intergenic
1187413076 X:19068013-19068035 CTTTTACATTTCTACAAGCAAGG - Intronic
1187429119 X:19205534-19205556 CTCAGTGCTTTCTACAAGCCAGG + Intergenic
1188146047 X:26615174-26615196 CTCAGACAATCCTCCCAGCTTGG + Intergenic
1191688988 X:63920831-63920853 CTCAGAAATTCCCAGAAGCTAGG - Intergenic
1193305757 X:79949499-79949521 CCCAGACATTTCTAGACACTCGG + Intergenic
1193936726 X:87632054-87632076 CTCAGGTAATTCTACAACCTGGG - Intronic
1196989872 X:121316494-121316516 CTCATACATTTTTAAAATCTGGG + Intergenic
1198110721 X:133500625-133500647 CTCAGATATTTCTTCCACCTAGG + Intergenic
1202383761 Y:24303290-24303312 TTCAGAAATTCCTATAAGCTTGG - Intergenic
1202487022 Y:25366830-25366852 TTCAGAAATTCCTATAAGCTTGG + Intergenic