ID: 953731375

View in Genome Browser
Species Human (GRCh38)
Location 3:45451914-45451936
Sequence CCTAGGAGTAAATTTAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2573
Summary {0: 1, 1: 11, 2: 210, 3: 756, 4: 1595}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953731375_953731378 4 Left 953731375 3:45451914-45451936 CCTTGCTTAAATTTACTCCTAGG 0: 1
1: 11
2: 210
3: 756
4: 1595
Right 953731378 3:45451941-45451963 TTATTTGTAACTCTTATAAATGG 0: 1
1: 4
2: 82
3: 553
4: 1772
953731375_953731379 5 Left 953731375 3:45451914-45451936 CCTTGCTTAAATTTACTCCTAGG 0: 1
1: 11
2: 210
3: 756
4: 1595
Right 953731379 3:45451942-45451964 TATTTGTAACTCTTATAAATGGG 0: 1
1: 5
2: 72
3: 488
4: 1596

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953731375 Original CRISPR CCTAGGAGTAAATTTAAGCA AGG (reversed) Intronic