ID: 953731376

View in Genome Browser
Species Human (GRCh38)
Location 3:45451914-45451936
Sequence CCTTGCTTAAATTTACTCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2158
Summary {0: 1, 1: 11, 2: 190, 3: 620, 4: 1336}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953731373_953731376 29 Left 953731373 3:45451862-45451884 CCTTTTCAATTACTATCATCAAT 0: 1
1: 1
2: 24
3: 255
4: 1109
Right 953731376 3:45451914-45451936 CCTTGCTTAAATTTACTCCTAGG 0: 1
1: 11
2: 190
3: 620
4: 1336
953731374_953731376 -7 Left 953731374 3:45451898-45451920 CCTTAGAGATCTTTAACCTTGCT 0: 1
1: 0
2: 1
3: 9
4: 141
Right 953731376 3:45451914-45451936 CCTTGCTTAAATTTACTCCTAGG 0: 1
1: 11
2: 190
3: 620
4: 1336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953731376 Original CRISPR CCTTGCTTAAATTTACTCCT AGG Intronic