ID: 953731378

View in Genome Browser
Species Human (GRCh38)
Location 3:45451941-45451963
Sequence TTATTTGTAACTCTTATAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2412
Summary {0: 1, 1: 4, 2: 82, 3: 553, 4: 1772}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953731374_953731378 20 Left 953731374 3:45451898-45451920 CCTTAGAGATCTTTAACCTTGCT 0: 1
1: 0
2: 1
3: 9
4: 141
Right 953731378 3:45451941-45451963 TTATTTGTAACTCTTATAAATGG 0: 1
1: 4
2: 82
3: 553
4: 1772
953731375_953731378 4 Left 953731375 3:45451914-45451936 CCTTGCTTAAATTTACTCCTAGG 0: 1
1: 11
2: 210
3: 756
4: 1595
Right 953731378 3:45451941-45451963 TTATTTGTAACTCTTATAAATGG 0: 1
1: 4
2: 82
3: 553
4: 1772

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953731378 Original CRISPR TTATTTGTAACTCTTATAAA TGG Intronic