ID: 953731379 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:45451942-45451964 |
| Sequence | TATTTGTAACTCTTATAAAT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2162 | |||
| Summary | {0: 1, 1: 5, 2: 72, 3: 488, 4: 1596} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 953731374_953731379 | 21 | Left | 953731374 | 3:45451898-45451920 | CCTTAGAGATCTTTAACCTTGCT | 0: 1 1: 0 2: 1 3: 9 4: 141 |
||
| Right | 953731379 | 3:45451942-45451964 | TATTTGTAACTCTTATAAATGGG | 0: 1 1: 5 2: 72 3: 488 4: 1596 |
||||
| 953731375_953731379 | 5 | Left | 953731375 | 3:45451914-45451936 | CCTTGCTTAAATTTACTCCTAGG | 0: 1 1: 11 2: 210 3: 756 4: 1595 |
||
| Right | 953731379 | 3:45451942-45451964 | TATTTGTAACTCTTATAAATGGG | 0: 1 1: 5 2: 72 3: 488 4: 1596 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 953731379 | Original CRISPR | TATTTGTAACTCTTATAAAT GGG | Intronic | ||