ID: 953731624

View in Genome Browser
Species Human (GRCh38)
Location 3:45454627-45454649
Sequence AACATGGAATTGGCTTCAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953731624 Original CRISPR AACATGGAATTGGCTTCAGT AGG Intronic
905302770 1:36997059-36997081 TACATGGAATTGGCTTCTTCTGG - Intronic
905929558 1:41777496-41777518 ACCAGGGACTTGGCTTCACTGGG - Intronic
906986073 1:50684619-50684641 ACCTTGAAATTGGCTTCAGTGGG - Intronic
910119924 1:83776234-83776256 AAAATGCAGCTGGCTTCAGTAGG + Intergenic
911842850 1:102706383-102706405 AACACGGAAGTGGGTTCATTAGG + Intergenic
913127473 1:115806062-115806084 AAAATGGCTTTGGATTCAGTGGG + Intergenic
916902753 1:169247396-169247418 AACATGGATTTGGCTTCTAATGG - Intronic
917075077 1:171196792-171196814 CACCTGGAAATGACTTCAGTGGG - Exonic
917352628 1:174093857-174093879 AAAATGGAAATGTGTTCAGTGGG - Intergenic
1067981349 10:51089076-51089098 AAAATGGAAATGCCTTCAGAGGG - Intronic
1070381282 10:75882740-75882762 ATCATGGAGTTGGCATCAGGTGG - Intronic
1072846197 10:98833200-98833222 AAAATGGAATTGGATTCCTTGGG + Intronic
1073706164 10:105986892-105986914 AACATGAAAATGGCCTCAGCAGG + Intergenic
1074629163 10:115230973-115230995 AGCATGGAGTTGGCATTAGTTGG + Intronic
1083607177 11:63986148-63986170 AAAACGGAATTGGCTCCAGGAGG + Exonic
1084888722 11:72225975-72225997 GACATTGAGTTGGCTTCTGTGGG + Intronic
1087379638 11:97387989-97388011 AACATGGAATTCCTTTCATTAGG - Intergenic
1094220208 12:27984902-27984924 GCCATGGAGTTGGCTGCAGTGGG - Intergenic
1096221415 12:49830652-49830674 AACATTGAATAGGGATCAGTGGG + Intergenic
1097289603 12:57903525-57903547 AATATGGGATTGACTTTAGTGGG + Intergenic
1097561465 12:61211873-61211895 AACATGGAACAAGCATCAGTGGG + Intergenic
1102999303 12:117373073-117373095 ATCTTGGAATTGGCTTCTGGAGG + Intronic
1103647903 12:122409512-122409534 AACTAGGAATTGGTTTCATTTGG + Intronic
1105573215 13:21623703-21623725 AAAATGGAATGGGCTTCATTGGG + Intergenic
1108626254 13:52231369-52231391 AGCATGGAAATGGCATGAGTAGG + Intergenic
1108659812 13:52575113-52575135 AGCATGGAAATGGCATGAGTAGG - Intergenic
1114152277 14:20056582-20056604 AACATGGACTCAGCTTCAGATGG - Intergenic
1115149275 14:30265405-30265427 AAGAAGGAATTTGCTTCAATTGG - Intergenic
1117433233 14:55691311-55691333 AACATGTGTTTGGCTCCAGTTGG + Intronic
1118513589 14:66503544-66503566 AAGATGGCATTGGCTTCTCTAGG - Intergenic
1126821629 15:52510226-52510248 AGCTTGAAAATGGCTTCAGTGGG - Intronic
1128138301 15:65280689-65280711 AAGATGGAAATGGCATCAGGAGG + Intronic
1128709841 15:69863620-69863642 AACAAGAAACTGGCTTGAGTAGG - Intergenic
1128718465 15:69927799-69927821 AGCTTGAAATTGGCTACAGTGGG - Intergenic
1128806615 15:70535914-70535936 AACAGGAAACTGGCTTCAGATGG - Intergenic
1130012138 15:80160218-80160240 AATATAGAAACGGCTTCAGTGGG + Intronic
1132920742 16:2390173-2390195 AACATGAAATTGGCTGTGGTGGG - Intergenic
1135465680 16:22682788-22682810 AGCTTGGAATTGGCCACAGTGGG + Intergenic
1137463729 16:48689249-48689271 AACCTGAAATTGGCCTCAGAGGG - Intergenic
1137868360 16:51925310-51925332 ACCATGGAATTTACTTAAGTTGG + Intergenic
1140401012 16:74671599-74671621 AACCTGGAGGGGGCTTCAGTGGG - Intergenic
1141662901 16:85451221-85451243 ACCATGGAATTTTCTGCAGTTGG - Intergenic
1141726522 16:85792828-85792850 GACATGGAAATGGATTCATTGGG - Intronic
1143377978 17:6478550-6478572 CTGATGGGATTGGCTTCAGTGGG - Exonic
1147357059 17:39906446-39906468 AAGATGGAAGTGGGGTCAGTGGG - Intronic
1150985071 17:70186644-70186666 AGCATGTAACTGGTTTCAGTAGG - Intergenic
1156191761 18:34728605-34728627 AACAAGGACTTGGGTACAGTTGG + Intronic
1157984135 18:52418349-52418371 AACATGAAAATGGCCTCTGTAGG + Intronic
1158229361 18:55236350-55236372 AAAATGGAATGGGCTTCTTTGGG - Intronic
1158742163 18:60155406-60155428 ACCACGGAGTTGGCTTCAGAGGG - Intergenic
1159426310 18:68292077-68292099 AAGATGGAATTTGTTTCACTTGG - Intergenic
1162124684 19:8493157-8493179 GCCAAGGAATTGGCTTCAGGTGG + Intronic
1167271300 19:48508067-48508089 GGCAGGGAATTGGCTTCCGTGGG + Intronic
926802339 2:16669549-16669571 AACATGGACTAGGCTTCAGAGGG + Intergenic
926827697 2:16923986-16924008 AACATTGCATTTGCTTAAGTGGG + Intergenic
930273830 2:49288311-49288333 CACATTGAATTAGCTTGAGTTGG + Intergenic
930992309 2:57672190-57672212 GACCTGGAATAGTCTTCAGTAGG + Intergenic
932290103 2:70569881-70569903 AAAATGGAATTGGCATAATTGGG + Intergenic
934967423 2:98734718-98734740 GATATGGAATGGGATTCAGTGGG - Intergenic
935093771 2:99924084-99924106 AACATGGGAATAGCTTAAGTTGG - Intronic
939472267 2:142638069-142638091 AACACGGGATTGTCCTCAGTGGG + Intergenic
940493198 2:154391435-154391457 AATATGCAATTTGATTCAGTTGG - Intronic
942622087 2:177855758-177855780 AACATGGCAATTGCTTCAGGTGG + Intronic
946072354 2:217045313-217045335 AACATGTGATTGGGTTCAGATGG - Intergenic
947674521 2:231965835-231965857 AACATGGACGTGGCATCAGAGGG - Intronic
948180833 2:235978650-235978672 AACCTGGAAAAGGCTTCAGGGGG + Intronic
948748081 2:240110135-240110157 CACATGGAATTGGATGCACTGGG + Intergenic
1169024916 20:2362237-2362259 ACCCTGGAATTTGCTTCAGCTGG + Intergenic
1169340990 20:4796007-4796029 AGCATGGTCTTGGCTTCTGTGGG - Intronic
1171298781 20:24041403-24041425 AACACGGAATTGACTTCTGGTGG + Intergenic
1172053008 20:32133678-32133700 CATATGGAATTGGCCCCAGTGGG - Intronic
1175167263 20:57053731-57053753 AACAAGAAATTGGGATCAGTAGG - Intergenic
1177509487 21:22066234-22066256 AACATGAAATTGGGTTAAGAAGG + Intergenic
1178113767 21:29396400-29396422 ACCATGGAATAAGCTGCAGTGGG - Intronic
1179110125 21:38439041-38439063 AACATGGCAATGGCTCCAGGTGG + Intronic
1179561178 21:42217154-42217176 AATAGGCAATTGGCTTCAGCCGG - Intronic
1181933757 22:26425160-26425182 AACAAGGAATTGGGAGCAGTAGG - Intergenic
950448786 3:13054163-13054185 AACAAGGCAGTGGCTTCAATAGG + Intronic
950955099 3:17044473-17044495 AACCTTTAATTTGCTTCAGTTGG + Intronic
951295975 3:20935162-20935184 ACCATGAATTTGGTTTCAGTTGG - Intergenic
953731624 3:45454627-45454649 AACATGGAATTGGCTTCAGTAGG + Intronic
957037615 3:75309491-75309513 CACATGGTCTTGGCTACAGTGGG + Intergenic
957752504 3:84440248-84440270 AACATAAAATTGTATTCAGTAGG + Intergenic
959121767 3:102241337-102241359 CACATGGAAGTGGATTCACTGGG + Intronic
960745596 3:120884451-120884473 AACATGGTATTGACTTCCATAGG + Intergenic
961085645 3:124065028-124065050 CACATGGTCTTGGCTACAGTGGG + Intergenic
964681047 3:159339102-159339124 AACCTGGAGATGGCTTCATTTGG - Intronic
966343881 3:178956772-178956794 AAGATCTAATTGTCTTCAGTAGG - Intergenic
967599327 3:191366021-191366043 AACATGGTGTTGGCTTCCTTAGG - Intronic
967609971 3:191492743-191492765 AACCTGAAATTGGCAACAGTGGG - Intergenic
967754075 3:193148979-193149001 CACAGGGATTTGGCTTCAGAAGG - Intergenic
969398005 4:6935403-6935425 AACAGAGAAGTGGCTTCAGCTGG + Intronic
970534354 4:17014042-17014064 AGCATGGAGCTGGCTTCAGAAGG - Intergenic
974416732 4:61617675-61617697 AACATTGAAGTGGCTTGATTTGG - Intronic
976912924 4:90330288-90330310 ATCATGTATTAGGCTTCAGTTGG + Intronic
977550920 4:98442604-98442626 ACCATGGATTTGACATCAGTAGG - Intronic
978141764 4:105325979-105326001 AACATCACACTGGCTTCAGTGGG - Intergenic
979755630 4:124337215-124337237 AATATGGAATAGTCTTCATTTGG - Intergenic
979770290 4:124515892-124515914 AGCATGGATTTGGTCTCAGTTGG - Intergenic
979771235 4:124527049-124527071 AACATGGAATTTTCTTCCTTTGG + Intergenic
980745297 4:137004798-137004820 AACATGCAGTTGGATTCATTAGG + Intergenic
981006824 4:139883674-139883696 AACATGGAAGTGGCTGCCTTTGG + Intronic
985929577 5:3046737-3046759 AACCTGGAATCATCTTCAGTGGG + Intergenic
987085485 5:14463823-14463845 GACATGGGATTGGCCTCAGCCGG + Intronic
987607018 5:20149581-20149603 TACATGGAAATGGTTCCAGTAGG - Intronic
988101558 5:26686141-26686163 AACATGGAATGCCCTTCAGTAGG + Intergenic
988235547 5:28539156-28539178 AACATGTAAATGGCTTCTGACGG + Intergenic
990256296 5:53974086-53974108 AACATGGGATTTGTTTCTGTGGG - Intronic
992164387 5:74034717-74034739 GACATGAATTTGGCTTTAGTGGG + Intergenic
996436081 5:123433691-123433713 AACATGGACATGGTTTCTGTAGG - Intergenic
999309888 5:150545159-150545181 AACAAGGACTTGCCTCCAGTGGG - Intronic
1001520451 5:172388304-172388326 TAGATCAAATTGGCTTCAGTTGG + Intronic
1003444697 6:6173895-6173917 AACATGGATTTTGATTCAGAGGG + Intronic
1004630637 6:17417870-17417892 ACCAAGGAATTTGCTTCAGGAGG - Intronic
1007969669 6:46037999-46038021 AGCCTGGGATTGGCCTCAGTGGG + Intronic
1008390253 6:50942207-50942229 CTCTTGCAATTGGCTTCAGTTGG - Intergenic
1008559994 6:52714285-52714307 AAGATGGACTTGGTTTCAATTGG - Intergenic
1009573127 6:65415310-65415332 AAATTGGATTTGCCTTCAGTTGG - Intronic
1011112884 6:83857738-83857760 AACATCCAACTGGCATCAGTAGG - Intergenic
1011204303 6:84875105-84875127 AAGATGGTATTGACTTCAGATGG - Intergenic
1012080488 6:94751908-94751930 AAAATGGAATTTCCCTCAGTGGG + Intergenic
1014981262 6:127948840-127948862 AAAATGGAATTGGTATCACTTGG + Intergenic
1015359299 6:132319796-132319818 AACAGGGAATTGTCTTAACTAGG - Intronic
1015625380 6:135176265-135176287 AACTTGAAATTGGCTCTAGTTGG - Intergenic
1016815960 6:148303314-148303336 AATATGTACTTGGCTTCTGTTGG - Intronic
1017279215 6:152605669-152605691 AACCTGGAATTGGTTTTAATTGG - Intronic
1022632014 7:32094175-32094197 AGCTTGGAATTGGCTACAGTGGG - Intronic
1026433658 7:70373566-70373588 AAGATGGAACTGGCATCAGTGGG + Intronic
1037847410 8:22295905-22295927 AAGATGGTATTGAATTCAGTAGG - Intronic
1038980475 8:32753933-32753955 GAGATGGAATTGGCATCACTGGG - Intronic
1041512666 8:58669064-58669086 AACATGAAATTGGCCATAGTGGG - Intergenic
1041896589 8:62931324-62931346 AATTTTGAATTGGTTTCAGTGGG + Intronic
1044698538 8:94947150-94947172 AACAAGGAATTGGAATCAGATGG - Intronic
1045015078 8:97994322-97994344 AACATGGAAGTAGCTTTATTGGG + Intronic
1050056396 9:1659961-1659983 AAAATGAAATAGACTTCAGTAGG + Intergenic
1051214032 9:14777252-14777274 ATTGTGAAATTGGCTTCAGTAGG - Intronic
1054948519 9:70823247-70823269 AACAAGGAAATGCCTTCAGGAGG - Intronic
1055891314 9:81127003-81127025 AAAATGGAACTGGGTTCAGTAGG - Intergenic
1186986361 X:15018531-15018553 AAGAGGGAATTGTCTTGAGTAGG + Intergenic
1188679455 X:32984056-32984078 AACATGGAATTTTCTTTAGCTGG - Intronic
1188795498 X:34458880-34458902 ATCATGAAATTGACTTCGGTGGG - Intergenic
1189282232 X:39827031-39827053 AGCTTGGAATTGGCTAGAGTAGG - Intergenic
1189544938 X:42033144-42033166 ACAAAGGAATTGGCTTCATTTGG - Intergenic
1191943183 X:66501692-66501714 AACAGGCAATTGGTTTCAATTGG + Intergenic
1192558710 X:72110638-72110660 AACAGGGAGTTGGTTTCTGTAGG + Intergenic
1195903966 X:109826132-109826154 AGCATGGAATGGACTACAGTAGG - Intergenic
1198173316 X:134129439-134129461 ACCATTTAATGGGCTTCAGTGGG + Intergenic
1198198130 X:134385549-134385571 AAGATGGAAAGGGCTTCAGCTGG + Intronic
1200912690 Y:8545199-8545221 AAGAAGGAATTGGCTTTATTAGG - Intergenic