ID: 953733153

View in Genome Browser
Species Human (GRCh38)
Location 3:45467049-45467071
Sequence CAGAATGGGCACAAATGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 264}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953733153 Original CRISPR CAGAATGGGCACAAATGGCC AGG Intronic
900173554 1:1281980-1282002 GAGACAGGGCACACATGGCCCGG - Intronic
900579751 1:3403152-3403174 CAGAAGGGGCACATATCCCCAGG - Intronic
902371644 1:16011196-16011218 GAAAATCTGCACAAATGGCCAGG + Intergenic
904300446 1:29550327-29550349 CAGGAGGGGCAAAAAGGGCCAGG - Intergenic
904780919 1:32947096-32947118 GAGAATGGGCAAAAATGGTTGGG - Intronic
905146432 1:35890316-35890338 AAGAATGGTAACAATTGGCCGGG - Intronic
906540731 1:46583797-46583819 CACACAGGGCACAAATGGCCTGG + Intronic
906863437 1:49388656-49388678 AAGCATTGCCACAAATGGCCAGG + Intronic
906920717 1:50061736-50061758 CACACTGGGCAGAAATGGCCAGG - Intronic
907704322 1:56819631-56819653 CTGCCTGGGCACAAATGCCCTGG - Intronic
907722318 1:56983570-56983592 AAGAATGGGCTCTCATGGCCAGG + Intergenic
907722659 1:56986683-56986705 AAGAATGGGCTCTCATGGCCAGG - Intergenic
908952118 1:69573251-69573273 CAGAATGGGGAAAAATGAACAGG - Intronic
909026291 1:70486149-70486171 AAGAATGAGCAAAAATGGGCCGG + Intergenic
910932630 1:92457703-92457725 AAGAATGGCCACAGAGGGCCAGG - Intergenic
912003396 1:104862556-104862578 TAGAATGAGAAAAAATGGCCCGG + Intergenic
915144098 1:153784460-153784482 CAAAAAGGGAACATATGGCCGGG - Intergenic
917019120 1:170567341-170567363 CAGAATGGTCACGAGAGGCCTGG - Intergenic
917100050 1:171436056-171436078 CAGAGTTGGCATAAATGACCAGG + Intergenic
917903163 1:179563967-179563989 CACAGTGGGCAGAAATGGCACGG - Intronic
922089522 1:222382396-222382418 CAGAAAGGGCAGAAAGGGCAAGG + Intergenic
922474792 1:225899392-225899414 CAGATAGGGCCCAAAAGGCCAGG - Intronic
923017638 1:230139324-230139346 CAGAAGGGACACATGTGGCCAGG - Intronic
1063317646 10:5021832-5021854 CACAATGGGCACAAATATGCGGG - Intronic
1065275345 10:24080030-24080052 CAGAAGGGCCACAGAAGGCCTGG - Intronic
1065849002 10:29771199-29771221 CAGAATGATCACAAAGGGCAGGG + Intergenic
1066738064 10:38496621-38496643 TAGAATGGACACAAATGGAAAGG + Intergenic
1066765874 10:38802189-38802211 TAGAATGGACTCAAATGGACTGG - Intergenic
1066775084 10:38879169-38879191 CAGAATGGTCTCAAATGGAATGG + Intergenic
1070828265 10:79403701-79403723 CAGCATGGGCCCAGAAGGCCTGG + Intronic
1076687536 10:132204813-132204835 AAGAAAGGGCACAGATGGGCAGG - Intronic
1078427930 11:11266420-11266442 AAGATTGGGCAGAAAGGGCCTGG - Intergenic
1078925979 11:15875386-15875408 CAAAATGGGAACAATCGGCCAGG - Intergenic
1087049317 11:93869520-93869542 CAGAATGGGATCAAATGGCTTGG + Intergenic
1087607427 11:100393767-100393789 CTAAATGGGAACAATTGGCCTGG + Intergenic
1088739251 11:112753363-112753385 CAGCAGGGGCACTGATGGCCAGG - Intergenic
1090063545 11:123484511-123484533 CAGGATGGGAACAAAGGACCCGG - Intergenic
1091624645 12:2112752-2112774 CACCATGGGCACAAAGGGCAGGG - Intronic
1091680347 12:2522487-2522509 CAGAATGGGCAGAAATGATTTGG + Intronic
1093456747 12:19372283-19372305 AAGAATGGCCATAATTGGCCGGG - Intronic
1095345804 12:41147775-41147797 CTGAATGGGAAAAAATGGCCAGG + Intergenic
1095544475 12:43348580-43348602 CAGAAGGGGCAGAAATGGCAAGG + Intergenic
1098796730 12:74898291-74898313 AAGAATAGGCAGAACTGGCCGGG + Intergenic
1101539263 12:105650221-105650243 CAAAATGGGCCAAAATGGCCAGG - Intergenic
1101898031 12:108770316-108770338 CAGGCTGGGCACAGAAGGCCAGG + Intergenic
1101898081 12:108770465-108770487 CAGGCTGGGCACAGAAGGCCAGG + Intergenic
1104574788 12:129957244-129957266 CAGAATGGTTTCAAGTGGCCAGG - Intergenic
1106459690 13:29958106-29958128 AAGAATGGGCACAAATGACTTGG + Intergenic
1107021710 13:35759072-35759094 CCTACTGGCCACAAATGGCCAGG + Intergenic
1107711813 13:43158065-43158087 CACATTGGGCAGAAATAGCCCGG + Intergenic
1109518020 13:63469481-63469503 AAGAAGGTGTACAAATGGCCTGG + Intergenic
1110574586 13:77041046-77041068 CCGCTTGGGCAGAAATGGCCAGG + Intergenic
1114261660 14:21041288-21041310 CAAAAAAGGCAAAAATGGCCAGG - Intronic
1118490548 14:66255295-66255317 CAGAAGGAGCCCAAAAGGCCTGG - Intergenic
1118969283 14:70619432-70619454 AAAAATGGGGACAATTGGCCGGG - Intergenic
1120682871 14:87501684-87501706 AAGAATGGGGAAAAATGGCAGGG + Intergenic
1121053158 14:90832490-90832512 AAGAATTGGAACAGATGGCCAGG + Intergenic
1122006211 14:98705950-98705972 GAGAATAAGCAGAAATGGCCGGG + Intergenic
1122334014 14:100954919-100954941 CAGAATGGACACACCTGGGCTGG + Intergenic
1202829717 14_GL000009v2_random:14194-14216 AAGAATGGCCTCAAATGACCAGG - Intergenic
1124452411 15:29807970-29807992 AAAAATGGGCAAAAGTGGCCAGG + Intronic
1129384643 15:75189287-75189309 CCTAATGGGGACAAAAGGCCTGG - Intergenic
1130917855 15:88319760-88319782 CTGTATGGGCACAGAAGGCCAGG + Intergenic
1131042896 15:89288848-89288870 CAGGATGGTCTCAAATGCCCTGG + Intronic
1133265747 16:4582617-4582639 CAGACTGTGCACCACTGGCCAGG + Intronic
1135505792 16:23034960-23034982 CTCATTGGGCAGAAATGGCCAGG - Intergenic
1135557705 16:23450896-23450918 AACAATGGGCACATCTGGCCGGG + Intronic
1138392642 16:56681889-56681911 CTGAATGGGCACATTTGCCCAGG - Intronic
1140568023 16:76066889-76066911 CATATAGGGCAGAAATGGCCTGG + Intergenic
1144314936 17:14050658-14050680 CACATTGGGCAGAAATGGCCAGG + Intergenic
1144755800 17:17680082-17680104 CAGAAGGGGCACAGCAGGCCTGG + Intergenic
1146086858 17:29838124-29838146 CAGAGTGGGCACCAACAGCCAGG - Intronic
1148954547 17:51343004-51343026 CAGAATGGACACCAAGAGCCAGG + Intergenic
1150761635 17:67967435-67967457 AAGAATATGCACAATTGGCCGGG - Intronic
1151082203 17:71342115-71342137 TAAAATGGCCAGAAATGGCCGGG + Intergenic
1152003129 17:77659566-77659588 AAGAATGTGCACAGAGGGCCGGG + Intergenic
1203177628 17_KI270729v1_random:30967-30989 CAGAATGGACTCAAATGGAATGG + Intergenic
1156844161 18:41644707-41644729 CAAAATGTGCAAAGATGGCCAGG + Intergenic
1158119875 18:54037301-54037323 CAATATGGACATAAATGGCCAGG + Intergenic
1158810361 18:61026502-61026524 CAGAGTGGGCACAAAAGCCTAGG + Intergenic
1159539003 18:69751707-69751729 TAAAATTTGCACAAATGGCCGGG + Intronic
1159913888 18:74172010-74172032 GAAAAAGGGCACAAACGGCCAGG - Intergenic
1161614578 19:5262903-5262925 CAGAAGGGGCACAAAGGGGATGG + Intronic
1163648132 19:18501858-18501880 CAGCATGGGCACCAGTGACCAGG + Intronic
1164888723 19:31804978-31805000 TAGAAGGGGCCCAAATGGCTTGG - Intergenic
1165118740 19:33545556-33545578 CAGGTTAGGCACAAATGGCCAGG + Intergenic
1165314000 19:35043859-35043881 CCGAATGGACAGAGATGGCCTGG + Intronic
1168285116 19:55327607-55327629 CACATTGGGCAGAAACGGCCAGG + Intronic
1168551711 19:57301909-57301931 CAGCTTGGGCCCAAAGGGCCAGG + Intergenic
1202642975 1_KI270706v1_random:113591-113613 AAGAATGGCCTCAAATGACCAGG + Intergenic
926222986 2:10948518-10948540 AAGATAGGGCACTAATGGCCTGG + Intergenic
929268621 2:39947280-39947302 CACATTGGGCAGAAATGACCAGG + Intergenic
931722680 2:65078837-65078859 CAAAATGGGCTCAAGTGGCTGGG - Intronic
932451572 2:71813941-71813963 CAGATTGGCCACAACTGGCGGGG - Intergenic
935979543 2:108613463-108613485 CAGACTGGACACAGAGGGCCAGG - Intronic
936168513 2:110146133-110146155 AAGAAGGGACACAAATGGGCAGG - Intronic
940611845 2:156003291-156003313 CAGAAAGGGCACAATTGTCATGG - Intergenic
942266408 2:174230939-174230961 CAGAATGGGCACAGGTCCCCAGG - Intronic
943036768 2:182756447-182756469 CAGAATGGAAAAGAATGGCCCGG + Exonic
943043355 2:182829078-182829100 CAGAATAGGCAAGAATGGCCAGG + Intergenic
944529353 2:200652067-200652089 CAAAATAGGAACAAATGGCAGGG + Intronic
946558761 2:220889467-220889489 CAGCATGGGCAGAGATGCCCTGG - Intergenic
948483659 2:238266330-238266352 CAGGATGGTCTCAAATGCCCAGG + Intronic
1168813392 20:720738-720760 CACATGGGGCAGAAATGGCCAGG + Intergenic
1168986949 20:2057450-2057472 CAGAATGGCTACTAATGGCTGGG + Intergenic
1169326997 20:4684562-4684584 AGGAAAGGGCTCAAATGGCCTGG - Intergenic
1170456890 20:16541853-16541875 CAGGTTGGGCACAGATGGCCAGG + Intronic
1171919514 20:31087081-31087103 TAGAATGGGCACGAATGGAAGGG + Intergenic
1171928013 20:31205240-31205262 TAGAATGGGCACGAATGGAAGGG + Intergenic
1172660640 20:36565999-36566021 AAAAATAGGCACATATGGCCAGG - Intergenic
1173156523 20:40617086-40617108 CTGAATGGGTTCAAATAGCCTGG - Intergenic
1173394097 20:42661917-42661939 CAGAATGGCCAGCAATGGACAGG + Intronic
1174488314 20:50874884-50874906 CAGAGTGGGCAGAGGTGGCCAGG + Intronic
1174926360 20:54764120-54764142 CATGATGGGCAAAACTGGCCTGG + Intergenic
1175533731 20:59692654-59692676 CAGTGTGAGCACAAAAGGCCTGG + Intronic
1175919714 20:62445026-62445048 CAGGATGGGCACATGTGGCCCGG - Intergenic
1176112477 20:63416890-63416912 CTGAGTGGGCACAGATGGTCTGG - Intronic
1176193122 20:63823193-63823215 AAAAATGGGAACAAAAGGCCAGG + Intronic
1176608902 21:8859034-8859056 AAGAATGGCCTCAAATGACCAGG - Intergenic
1177055940 21:16300947-16300969 CAGAATGGTCAGGAAAGGCCAGG - Intergenic
1178966324 21:37122371-37122393 CAGAATTAGCACAAATGGTGCGG - Intronic
1179183653 21:39066502-39066524 TACAATGGGCACATATGACCTGG + Intergenic
1179382349 21:40911205-40911227 CTGCATTGGCAGAAATGGCCTGG - Intergenic
1180358991 22:11868866-11868888 AAGAATGGTCTCAAATGACCAGG - Intergenic
1181816149 22:25438105-25438127 CAGAATGTGACCCAATGGCCTGG - Intergenic
1182398733 22:30057464-30057486 CAGAATGAACCCAAATGGGCCGG + Intergenic
1183695248 22:39418051-39418073 CAGAATAGGGACTAAAGGCCAGG - Intronic
1185322057 22:50205990-50206012 CACAGTGGGGACAAAGGGCCTGG - Intronic
949496843 3:4640457-4640479 CAGAATGGACACAGGTGTCCAGG + Intronic
952192211 3:31035720-31035742 TACATTGGGCAAAAATGGCCAGG - Intergenic
953240363 3:41143301-41143323 CAGAATGGGGACAAAATGTCAGG - Intergenic
953733153 3:45467049-45467071 CAGAATGGGCACAAATGGCCAGG + Intronic
954290036 3:49644803-49644825 CAGAATGTGCACGAATGGGAGGG + Intronic
955082116 3:55667484-55667506 TAGCATGTGCACAAATAGCCAGG - Intronic
955209903 3:56931072-56931094 CAGAATTGGTACAAATGGATCGG - Intronic
956986896 3:74711930-74711952 CAGAATGGGCGCAAAGGCCGAGG - Intergenic
959486350 3:106931019-106931041 CATGTTGGGCAGAAATGGCCAGG + Intergenic
959679076 3:109072222-109072244 GAGAATGGTCCTAAATGGCCAGG - Intronic
959743368 3:109747483-109747505 CACATTGGGCAGAAATGGCAAGG - Intergenic
963121871 3:141783362-141783384 CAACGTGGGCACACATGGCCTGG - Intronic
964656534 3:159073143-159073165 CACAGTGGGCAGAAATGACCAGG + Intronic
966010897 3:175075563-175075585 CAGAATGGCCACCACTGGCTTGG - Intronic
966185618 3:177224084-177224106 CAGAATGGGCACAAAGGACCTGG - Intergenic
966388708 3:179429070-179429092 CAGAATGTGCAGGAAGGGCCCGG - Intronic
966429831 3:179819923-179819945 CAGAATGGGAAGAAATGGCTCGG - Exonic
967615621 3:191561569-191561591 CAAAATGGAGACAAATGGTCAGG + Intergenic
967912864 3:194556440-194556462 CTGAATGGCCACACAAGGCCTGG + Intergenic
969701252 4:8768957-8768979 CACACTGGGTCCAAATGGCCAGG - Intergenic
970105716 4:12580969-12580991 CACATTGGGGACAAATAGCCTGG - Intergenic
973045067 4:45526443-45526465 CACATTGGGCAGAAATGGTCAGG - Intergenic
973737345 4:53885668-53885690 CAGAATGTGCACAGGAGGCCAGG + Intronic
975725201 4:77284989-77285011 CAGAAAGGGAACAAGTGTCCTGG - Intronic
978331861 4:107621943-107621965 CAGAGTGAGCACAAATGGCTGGG + Intronic
978810119 4:112840365-112840387 CAGAAGGGGAACAATTTGCCTGG + Intronic
980339799 4:131530867-131530889 CAGAATTGGCAAAAATGCCTGGG - Intergenic
981523634 4:145690803-145690825 CAAAAAGTGCACAAAGGGCCAGG + Intronic
1202770344 4_GL000008v2_random:199486-199508 AAGAATGGCCTCAAATGACCAGG + Intergenic
985962330 5:3312012-3312034 CTGCATGGGTACAAATGGCCAGG + Intergenic
987299481 5:16584680-16584702 CAGAATCTGCATAAAAGGCCAGG - Intronic
987355774 5:17062091-17062113 CAGAATGGGCACCAAGGCCAAGG - Intergenic
989963076 5:50439277-50439299 CAGAAGGGGGAAAAATGTCCTGG + Intronic
990662527 5:58033179-58033201 CAGGGTGGGCAGAAATGGGCAGG + Intergenic
996668909 5:126093707-126093729 CATGTTGGGCCCAAATGGCCAGG - Intergenic
997160330 5:131601736-131601758 TAAAATTGGCACAATTGGCCGGG + Intronic
997244761 5:132338038-132338060 AAGAATGGGCAAAGAAGGCCAGG - Intronic
997294832 5:132762808-132762830 CAGAATGGCCACAGGTGGCTGGG - Intronic
997718642 5:136060881-136060903 CATCATGGCCACAAATGGCGTGG + Exonic
998151985 5:139762860-139762882 CAGAGTGGGGAGAGATGGCCTGG + Intergenic
999410196 5:151343844-151343866 CACAAAGGGCACACATGGTCAGG - Intronic
999420401 5:151436970-151436992 CACAATGGGAACAAAGGGCCTGG - Intergenic
999477099 5:151910563-151910585 CAGAAAAGTCAAAAATGGCCAGG - Intronic
1000547540 5:162621717-162621739 CAGAATGGGCACCAAGGCCAAGG - Intergenic
1000996863 5:167968212-167968234 CAGAATGGCCCCAAATTGTCTGG - Intronic
1005720914 6:28601198-28601220 AAAAATGGGCACATGTGGCCGGG - Intronic
1006489975 6:34378939-34378961 CAGACTGGGCAGAAGAGGCCAGG - Intronic
1009045956 6:58237706-58237728 CAGGGTGGGCACTTATGGCCAGG + Intergenic
1009221773 6:60992019-60992041 CAGGGTGGGCACTTATGGCCAGG + Intergenic
1009885386 6:69618275-69618297 AAGAAAGGGTACAATTGGCCAGG + Intergenic
1012151025 6:95753275-95753297 CAGATTGGGAACCAATGGCGTGG + Intergenic
1015430828 6:133128910-133128932 AAGAATGGGAGCAAATGGCAGGG - Intergenic
1018447455 6:163870521-163870543 CAGAAGGGGCACATGTGACCAGG + Intergenic
1020014804 7:4824721-4824743 CAGAATGGGCAAAAAGGAGCAGG - Intronic
1021133807 7:16942863-16942885 CAGAATGGGCACCAAGGCCAAGG - Intergenic
1021316876 7:19158518-19158540 CATACTGGGCAAAAATGGTCAGG - Intergenic
1021736941 7:23648456-23648478 CAGAAAGTACACACATGGCCAGG - Intergenic
1022292423 7:29017083-29017105 CAGAATGGGAACATCAGGCCTGG - Intronic
1023154930 7:37239780-37239802 CATAATGGGTAGAAATGACCAGG + Intronic
1023710372 7:42986232-42986254 CAGAAGGGGCAGAGATGGGCAGG + Intergenic
1023962393 7:44937774-44937796 CAGATGGGGCACAACTGGGCAGG + Intergenic
1024207869 7:47179249-47179271 TAGAATTGGCACGAATGGCTAGG + Intergenic
1024929778 7:54657872-54657894 CATAAAGGGCACAAAGAGCCAGG - Intergenic
1028455961 7:91038608-91038630 TGGAATGGGCACAGATGTCCAGG + Intronic
1028989425 7:97034214-97034236 CAGAATGGGCACCAAGGCCGAGG - Intergenic
1029306834 7:99625756-99625778 CAGAACAGTCAGAAATGGCCAGG - Intronic
1030520594 7:110593536-110593558 CAGAATGGGCACACCCAGCCAGG + Intergenic
1032787650 7:135213257-135213279 CAGAATGGTGACAATAGGCCGGG + Intergenic
1033555897 7:142488418-142488440 CAGAGTGGCCCCAAGTGGCCCGG + Intergenic
1035294784 7:157860938-157860960 CAGAACAGGCACAGATGGGCTGG + Intronic
1035715410 8:1750546-1750568 TAGAATGTGGACAATTGGCCAGG - Intergenic
1038567823 8:28634548-28634570 CAGGATGGGCAGAAAGAGCCAGG - Intronic
1039110895 8:34039790-34039812 CTGAATGTTCACAAAAGGCCAGG - Intergenic
1039511029 8:38092137-38092159 CAGAATGGGGTCCAATTGCCTGG - Intergenic
1040436837 8:47399284-47399306 CAGAGTGTGCACCCATGGCCAGG + Intronic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1042196881 8:66238481-66238503 CAGAATGGGCACCAACAGCAGGG + Intergenic
1045535763 8:103026165-103026187 CTGAATTGGCAGACATGGCCAGG - Intronic
1046002344 8:108436070-108436092 CACAATGGGCAGAAATTGCCAGG - Intergenic
1046829755 8:118731406-118731428 AAGGAAGGGCACAAATGCCCTGG - Intergenic
1048310826 8:133321365-133321387 TAAAGTGGGCTCAAATGGCCAGG - Intergenic
1049531241 8:143156694-143156716 GGGAATGGGCACCAATGCCCAGG + Intergenic
1049769339 8:144372696-144372718 CAGAAGGGGCACTAAAGGGCTGG + Intergenic
1050585214 9:7103768-7103790 CAGCATGGGCACAAGTGACATGG - Intergenic
1052707495 9:32010863-32010885 GAGGATGTGCACAACTGGCCAGG - Intergenic
1052751964 9:32501096-32501118 AAGAATGGGCACAGTCGGCCTGG - Intronic
1053126832 9:35588404-35588426 AAAAATAGGCACATATGGCCAGG + Intergenic
1054790676 9:69253738-69253760 CAGAATGGCCACAAGAGGCTGGG - Intronic
1055153947 9:73038181-73038203 CAGATTGGGCAAAAATGCCTTGG + Intronic
1058714237 9:107709218-107709240 CATATTAGGCAGAAATGGCCAGG + Intergenic
1058831185 9:108818328-108818350 CAAAATAGCCACACATGGCCAGG + Intergenic
1058935996 9:109770028-109770050 CAGAAAAGGCACAAATGCCAAGG - Intronic
1058941040 9:109812778-109812800 CAGAATCAGGACTAATGGCCTGG - Intronic
1059535062 9:115072971-115072993 CAGAATGGACACAAGTTGCATGG + Intronic
1059540331 9:115123919-115123941 CAGGATTGGCACAAATAGACAGG - Intergenic
1059936962 9:119321224-119321246 TAAAATGGGGACCAATGGCCGGG - Intronic
1060279651 9:122207172-122207194 GAGCATGGGCAGAACTGGCCGGG - Intronic
1062054651 9:134464506-134464528 CAGAGTGGGCACTAATGGGAGGG - Intergenic
1062054665 9:134464563-134464585 CAGAGTGGGCACTAATGGGGGGG - Intergenic
1062054681 9:134464620-134464642 CAGAGTGGGCACTAATGGGGGGG - Intergenic
1062054697 9:134464677-134464699 CAGAGTGGGCACTAATGGGGGGG - Intergenic
1062054713 9:134464734-134464756 CAGAGTGGGCACTAATGGGGGGG - Intergenic
1062054743 9:134464848-134464870 CAGAGTGGGCACTAATGGGGGGG - Intergenic
1062054787 9:134465019-134465041 CAGAGTGGGCACTAATGGGGGGG - Intergenic
1062054803 9:134465076-134465098 CAGAGTGGGCACTAATGGGGGGG - Intergenic
1062054819 9:134465133-134465155 CAGAGTGGGCACTAATGGGGGGG - Intergenic
1062054835 9:134465190-134465212 CAGAGTGGGCACTAATGGGGGGG - Intergenic
1062054851 9:134465247-134465269 CAGAGTGGGCACTAATGGGGGGG - Intergenic
1062054867 9:134465304-134465326 CAGAGTGGGCACTAATGGGGGGG - Intergenic
1062054883 9:134465361-134465383 CAGAGTGGGCACTAATGGGGGGG - Intergenic
1062054899 9:134465418-134465440 CAGAGTGGGCACTAATGGGGGGG - Intergenic
1062054915 9:134465475-134465497 CAGAGTGGGCACTAATGGGGGGG - Intergenic
1062054931 9:134465532-134465554 CAGAGTGGGCACTAATGGGGGGG - Intergenic
1062054947 9:134465589-134465611 CAGAGTGGGCACTAATGGGGGGG - Intergenic
1062054963 9:134465646-134465668 CAGAGTGGGCACTAATGGGGGGG - Intergenic
1062054979 9:134465703-134465725 CAGAGTGGGCACTAATGGGGGGG - Intergenic
1062054995 9:134465760-134465782 CAGAGTGGGCACTAATGGGGGGG - Intergenic
1062055025 9:134465874-134465896 CAGAGTGGGCACTAATGGGGGGG - Intergenic
1062055069 9:134466045-134466067 CAGAGTGGGCACTAATGGGGGGG - Intergenic
1062055085 9:134466102-134466124 CAGAGTGGGCACTAATGGGGGGG - Intergenic
1062055101 9:134466159-134466181 CAGAGTGGGCACTAATGGGGGGG - Intergenic
1062055117 9:134466216-134466238 CAGAGTGGGCACTAATGGGGGGG - Intergenic
1062055133 9:134466273-134466295 CAGAGTGGGCACTAATGGGGGGG - Intergenic
1062055149 9:134466330-134466352 CAGAGTGGGCACTAATGGGGGGG - Intergenic
1062055165 9:134466387-134466409 CAGAGTGGGCACTAATGGGGGGG - Intergenic
1062055181 9:134466444-134466466 CAGAGTGGGCACTAATGGGGGGG - Intergenic
1062055308 9:134466957-134466979 CAGAGTGGGCACTAATGGAGGGG - Intergenic
1062161211 9:135081123-135081145 AAGAATGGGGACAACTGCCCAGG - Intronic
1062648096 9:137560423-137560445 AAGAATGGGAAGAGATGGCCAGG + Intronic
1203724686 Un_GL000216v2:40141-40163 CAGAATGGACTCAAATGGAACGG - Intergenic
1203724730 Un_GL000216v2:40481-40503 CGGAATGGACACAAATGGAAGGG - Intergenic
1203725623 Un_GL000216v2:47224-47246 CAGAATGGACACGAATGGAATGG - Intergenic
1203727646 Un_GL000216v2:63206-63228 CAGAATGGACACAAATGGAATGG - Intergenic
1203727693 Un_GL000216v2:63545-63567 TAGAATGGACACAAATGGAATGG - Intergenic
1203342587 Un_KI270442v1:3716-3738 CAGAATGGGATCAAATGGATTGG + Intergenic
1203343676 Un_KI270442v1:16300-16322 CAGAATGGACACGAATGGAATGG + Intergenic
1203704301 Un_KI270742v1:24259-24281 AAGAATGGCCTCAAATGACCAGG - Intergenic
1203677712 Un_KI270756v1:37110-37132 CAGAATGGTCTCAAATGGAATGG - Intergenic
1185484400 X:471172-471194 CTGAATGGGCCCAGATGGCAGGG + Intergenic
1186388855 X:9137801-9137823 TAGAATGAGAACAAAAGGCCAGG - Intronic
1187254505 X:17630002-17630024 GAGAGAGGGCACAAATCGCCAGG + Intronic
1187498041 X:19813304-19813326 AGAAATGGGCAGAAATGGCCAGG - Intronic
1188491464 X:30742505-30742527 CACACTGGGCAGAAGTGGCCAGG + Intergenic
1189103845 X:38217388-38217410 CAGAATTTGGACAAATGGCAAGG + Intronic
1192962252 X:76143562-76143584 TAGAATTGGCACAAGTGACCAGG - Intergenic
1192963281 X:76151525-76151547 TAGAATTGGCACAAGTGACCAGG + Intergenic
1193139151 X:78007618-78007640 AAAAATGGGCAAAAATGGTCGGG - Intronic
1193980166 X:88172632-88172654 TACATTGGGCAGAAATGGCCAGG - Intergenic
1194483021 X:94450544-94450566 CAGAAAGGGAAGAAATAGCCAGG + Intergenic
1196688576 X:118534153-118534175 CAGAGTGAGCACAAAAAGCCAGG + Intronic
1196780700 X:119381530-119381552 CACATTGGGCAGAAGTGGCCAGG - Intergenic
1196863038 X:120045441-120045463 CAGAATGGGCAGAAAGAGCTGGG - Intergenic
1196880064 X:120190903-120190925 CAGAATGGGCAGAAAGAGCTGGG + Intergenic
1201105865 Y:10762900-10762922 CAGAATGGAATCAAATGGACTGG - Intergenic
1201108330 Y:10780302-10780324 CAGAATGGTGATAAATGGCATGG - Intergenic
1201199046 Y:11522543-11522565 CAGAATGGGCTCGAATGGAATGG + Intergenic