ID: 953735095

View in Genome Browser
Species Human (GRCh38)
Location 3:45487143-45487165
Sequence CTGTAACCACAGAATGTATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953735095_953735096 3 Left 953735095 3:45487143-45487165 CCAAATACATTCTGTGGTTACAG 0: 1
1: 0
2: 1
3: 13
4: 172
Right 953735096 3:45487169-45487191 CTCCTTTTAAACATTACTCCTGG 0: 1
1: 0
2: 2
3: 14
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953735095 Original CRISPR CTGTAACCACAGAATGTATT TGG (reversed) Intronic
905932076 1:41795849-41795871 CTGGAACTACAAAATGTTTTAGG + Intronic
908393206 1:63702256-63702278 CTGAAAGCACAGATTGTTTTCGG - Intergenic
911992263 1:104715045-104715067 ATGTAATCACAGGATGCATTAGG + Intergenic
913268632 1:117070336-117070358 CTGTAACCTAGGTATGTATTAGG - Intronic
915776047 1:158487534-158487556 CAGTAAACATAGAATGTATAAGG + Intergenic
917076240 1:171208104-171208126 CTCTAACCACAGAGTGTAGGTGG - Intronic
921911610 1:220555074-220555096 AAGTAACCACAGAATGGGTTTGG + Intronic
922902456 1:229147543-229147565 CCGGCACCTCAGAATGTATTTGG - Intergenic
923859549 1:237879463-237879485 CTATAACCACAGATCCTATTAGG - Intronic
1063358339 10:5424071-5424093 CACTAACCTCAGAATGCATTTGG - Intronic
1066683923 10:37962498-37962520 CTGTGTTCAGAGAATGTATTTGG - Intronic
1070047772 10:72856198-72856220 TTGTCACCACAGATTATATTAGG - Intronic
1073031965 10:100533688-100533710 CTGTAACAAGAGATTGAATTAGG - Intronic
1073065172 10:100754292-100754314 CAGTAACCCCAGACTCTATTTGG - Intronic
1075000546 10:118793865-118793887 CTGCAACCACAGACTGGTTTGGG - Intergenic
1077759144 11:5071973-5071995 CTGTAACCACAGCATGAATCAGG - Intergenic
1078174611 11:8960622-8960644 CTGTAAGCACTGAATAAATTTGG + Intronic
1080188806 11:29521817-29521839 CTGTAAGCACAGATTGCTTTTGG + Intergenic
1082249236 11:49960975-49960997 CTGTCAGCAGAGATTGTATTGGG - Intergenic
1086199024 11:84178094-84178116 CTGTACCCACAGAATTTTGTGGG - Intronic
1086742430 11:90384144-90384166 TTGTAACCTTAGAATTTATTCGG - Intergenic
1088567753 11:111190902-111190924 TTGAAACCACAGATTTTATTTGG + Intergenic
1089082980 11:115792941-115792963 CTGTGACCACAGGATGGATAAGG - Intergenic
1093502948 12:19833179-19833201 CTAAGACCACAGAATGGATTAGG - Intergenic
1094576113 12:31687257-31687279 CTGTAACCATAGATTGTATCTGG - Intronic
1094607496 12:31961288-31961310 CTGTAACCACAAAGTGTGTTAGG + Intronic
1095114325 12:38333824-38333846 CTGAAACCTTACAATGTATTTGG - Intergenic
1095205258 12:39432225-39432247 ATGTAAAGACACAATGTATTAGG - Intronic
1095211630 12:39501351-39501373 CTGTAGCTTCAGTATGTATTTGG - Intergenic
1099840768 12:87962971-87962993 CTCTACCCAGAGAATGTTTTTGG + Intergenic
1101689384 12:107061682-107061704 ATGCAACTAAAGAATGTATTAGG - Intronic
1101799950 12:108012953-108012975 TGGTAGCAACAGAATGTATTGGG - Intergenic
1104179320 12:126363100-126363122 CTGAAGCTACAGAATGCATTGGG + Intergenic
1105744865 13:23368033-23368055 CTCTAATCGTAGAATGTATTTGG + Intronic
1107460464 13:40597223-40597245 CCATAACCCCAGAATGTATTAGG + Intronic
1107509042 13:41062666-41062688 CAGTAATCACAGAATTTCTTTGG - Exonic
1108078646 13:46709494-46709516 CTGTACTCACAGAATGTACCAGG + Intronic
1108757563 13:53522382-53522404 GAGTGACCACAGAATTTATTTGG - Intergenic
1110047571 13:70849626-70849648 GTGTAAGCACAAAATGAATTAGG + Intergenic
1111153945 13:84297285-84297307 CCATCACCATAGAATGTATTAGG + Intergenic
1117479572 14:56129429-56129451 CTGGAACCAGTGAATGTTTTGGG + Intronic
1118366028 14:65096896-65096918 CTGTAACCATAGGATGTGTAGGG - Intronic
1118718156 14:68574953-68574975 CTCTAACCTCAGAGTGGATTTGG - Intronic
1118945100 14:70377947-70377969 CTGTAATCTCACAATGTATGAGG + Intronic
1120769528 14:88363744-88363766 TTGTAAACAGAGAATGCATTCGG + Intergenic
1125558372 15:40605757-40605779 CTTTAAGCACAAAATGTGTTGGG + Intronic
1126345370 15:47688195-47688217 GTGTTAACCCAGAATGTATTTGG + Intronic
1128634626 15:69295207-69295229 TGGTGACCACAGAATGCATTTGG + Intergenic
1128634823 15:69296437-69296459 TAGTGACCACAGAATGCATTTGG - Intergenic
1129068616 15:72932530-72932552 ATGTCACCACAGCATGTACTGGG - Intergenic
1129176573 15:73844422-73844444 CCTTAACCTCAAAATGTATTTGG - Intergenic
1131465490 15:92652149-92652171 CTGGAACCACACTAGGTATTAGG + Intronic
1134695034 16:16217644-16217666 TTGGAACCCCAGAATGTATATGG + Intronic
1139174943 16:64675579-64675601 GTGTAACCACTGAATGTAACTGG - Intergenic
1139605379 16:68014444-68014466 CTGTAACAGCACAATGTATAAGG - Intronic
1146530875 17:33606882-33606904 CTGTGACCACAGAATGGGATTGG - Intronic
1151390771 17:73785360-73785382 CTGTGACTCCAGAATGGATTTGG + Intergenic
1155331632 18:24724845-24724867 ATTTATCCACAGAATGTATATGG - Intergenic
1157064982 18:44338971-44338993 CTCTTAACACAGAATGTATCTGG - Intergenic
1157385556 18:47257154-47257176 ATGAAACCACAGCAAGTATTTGG + Intergenic
1158366383 18:56741940-56741962 CTAGAACCACAGGATTTATTAGG - Intronic
1158389000 18:57027700-57027722 ATGTAAACACAGAATCTTTTTGG - Exonic
1158987059 18:62828608-62828630 CTGTGCCCAAAGTATGTATTGGG + Intronic
1165172168 19:33901462-33901484 CTATAATCACAGAATCTGTTAGG + Intergenic
1166133367 19:40760405-40760427 CTGAAATCACAGAATGTAGCTGG + Intronic
1166145063 19:40828440-40828462 CTGTAATCCCAGAATATATTGGG + Intronic
1168103610 19:54153776-54153798 CTGGAACCACATCATGTACTTGG - Exonic
927194868 2:20540182-20540204 CTGTAGTCACAGAATGTTCTGGG - Intergenic
928899482 2:36301911-36301933 CTGTAAATTCAGAAAGTATTAGG - Intergenic
929055283 2:37871292-37871314 ATGTACCCACAGAATGCATTTGG + Intergenic
929624483 2:43392658-43392680 CAGTAAACACAGAATCTATTGGG + Intronic
929951879 2:46417472-46417494 CTGTGACCCCAAAATGTGTTGGG - Intergenic
931614263 2:64139727-64139749 CAATAAACACTGAATGTATTTGG + Intronic
931632629 2:64315173-64315195 GTGTAAACAGAGAATATATTTGG + Intergenic
933754667 2:85628838-85628860 CTTTAACCACAGAGGGGATTAGG - Intronic
934811449 2:97281672-97281694 CTGTGATCTCAGTATGTATTTGG - Intergenic
934826242 2:97426268-97426290 CTGTGATCTCAGTATGTATTTGG + Intergenic
936722812 2:115273903-115273925 CTGTAATCCCCAAATGTATTTGG - Intronic
937888790 2:126919231-126919253 CGGTATCCAGAGATTGTATTGGG + Intergenic
938231353 2:129662887-129662909 CTGTAACTACATAAATTATTTGG - Intergenic
939951044 2:148473438-148473460 CTGTAACCACAGAGTACAGTTGG - Intronic
943330603 2:186554109-186554131 CTATCACCATAGAATGTTTTAGG + Intergenic
943614346 2:190075234-190075256 TTGTAATCAGAGAATGTAGTTGG + Intronic
943844399 2:192625283-192625305 CTGTAACCCCAGAATATATCAGG - Intergenic
944582535 2:201144777-201144799 CTGTAACATCAGATTTTATTGGG + Intronic
945802867 2:214455080-214455102 CTGTCAGCATAGAATGAATTAGG + Intronic
946500061 2:220237655-220237677 CTAGTACCTCAGAATGTATTCGG - Intergenic
1172257449 20:33531545-33531567 GTGTGACCACAGAAATTATTAGG - Intronic
1172371066 20:34392442-34392464 ATGTAAGCACAGAATGAAGTAGG + Intronic
1172760293 20:37316649-37316671 CTGTGAGCATAGACTGTATTAGG + Exonic
1177358016 21:20033255-20033277 CTTTAGCCACAAAAAGTATTTGG + Intergenic
1177434627 21:21035000-21035022 CTGTAACAACTGTATGAATTGGG + Intronic
1177495727 21:21888678-21888700 CTGTATTAACAAAATGTATTAGG + Intergenic
1178031545 21:28532792-28532814 CTGGACTCACAGAATGAATTAGG + Intergenic
1178733583 21:35128998-35129020 ATGGAACCACAGAATGTTCTAGG - Intronic
1180639856 22:17289520-17289542 CTGTAACCCCAGCATGTACAAGG - Intergenic
1182829497 22:33293489-33293511 CAATAACCACAAGATGTATTGGG + Intronic
1182897964 22:33874202-33874224 CTCTAACCTCAGCATGTCTTAGG - Intronic
950394683 3:12724940-12724962 ATGAAAGAACAGAATGTATTTGG - Intergenic
952214376 3:31262215-31262237 TGGTAACCACAGAATGTTCTAGG + Intergenic
953735095 3:45487143-45487165 CTGTAACCACAGAATGTATTTGG - Intronic
954157448 3:48694336-48694358 CTTTAAGGACAGAATGTACTGGG - Intronic
957073401 3:75582558-75582580 ATATAACCAGAGAATGGATTTGG - Intergenic
957635849 3:82783517-82783539 CTCTACCCACAGAATGTATTCGG + Intergenic
957705310 3:83772537-83772559 CTATAACCTCAGAATGCACTAGG - Intergenic
957880625 3:86207552-86207574 CTGAAACCATGGAATGTATTGGG + Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960436404 3:117632418-117632440 CTGTCACCACAGTATGGGTTTGG + Intergenic
963276845 3:143340183-143340205 CTGGAACCTAAGACTGTATTAGG - Intronic
965193098 3:165557007-165557029 CTTTAAAAAAAGAATGTATTGGG + Intergenic
965651793 3:170941712-170941734 CTGTTACCACAGGATGTTCTTGG - Intergenic
965934580 3:174091646-174091668 CTGTAACAAAAATATGTATTTGG - Intronic
966479010 3:180383974-180383996 CTTTAAACAGAGAAAGTATTTGG + Intergenic
972229587 4:37055760-37055782 CTGAAACCAAACAATGCATTAGG - Intergenic
972995718 4:44877223-44877245 CTGTAACCACATTTTATATTTGG + Intergenic
973120646 4:46517507-46517529 TTGGAGCCACAGAATCTATTAGG + Intergenic
973257407 4:48127400-48127422 CTGTAATCACAGAATGCCTGTGG - Intronic
974421144 4:61676429-61676451 ATATAACCACAGAGTTTATTAGG - Intronic
974681468 4:65169110-65169132 CTGTAACCTATAAATGTATTAGG - Intergenic
976622762 4:87145723-87145745 TTGTAACCACAGAATATTGTGGG - Intergenic
976745167 4:88395265-88395287 TTGTAATCATAGAATGTTTTGGG + Intronic
979553604 4:122019348-122019370 CTGTATTCACAGACTGTATTGGG - Intergenic
980233821 4:130078233-130078255 CTGTAGCCCCAGAATTTATTAGG + Intergenic
981888554 4:149709153-149709175 CTAAAACCACATAATGTACTTGG + Intergenic
982858146 4:160411742-160411764 CTTTAACCATATAATGTAATTGG - Intergenic
984150683 4:176126360-176126382 CTGAAAGAACAGAATGTTTTTGG + Intronic
984241537 4:177225777-177225799 TTGTAACCACAGAAAGTAGGTGG + Intergenic
985010825 4:185580509-185580531 CCAGAACCTCAGAATGTATTTGG - Intergenic
992416348 5:76555888-76555910 TTGTAACCACAGAAGGTGTGGGG - Intronic
994442218 5:99823048-99823070 CTCTAACTAAAGAATTTATTTGG + Intergenic
994999131 5:107104799-107104821 CAGTAACCACTGAATGATTTAGG + Intergenic
995012543 5:107274194-107274216 CTGGTACCTCAGAATGTGTTTGG + Intergenic
996217138 5:120882688-120882710 GAGTACCCACAGAATGTACTGGG - Intergenic
999582488 5:153054898-153054920 CTGTGAACAAAGAAGGTATTTGG - Intergenic
1000082772 5:157863318-157863340 CTGTAACCACATTTTCTATTAGG + Intergenic
1001577535 5:172773914-172773936 CTGTAACCACAGAAGGAGTGAGG + Intergenic
1003617430 6:7668357-7668379 CTGAAATCACAGAAGGTGTTTGG + Intergenic
1004373346 6:15071629-15071651 CTGAAATCACAGAATGTAAGAGG + Intergenic
1007083282 6:39124133-39124155 CTGTCACCAAAGAAGATATTTGG + Intergenic
1009526007 6:64747356-64747378 CTGTAATCCCAGAATCTTTTTGG + Intronic
1010025414 6:71210160-71210182 CTCTAACAATAGAATGAATTTGG + Intergenic
1010528532 6:76936271-76936293 CTGTAAGGGCAGAATGTGTTTGG + Intergenic
1013005532 6:106069685-106069707 CTGGAAGAACAGACTGTATTAGG - Intergenic
1023917558 7:44601476-44601498 CTGTACCTAGAGAAGGTATTGGG - Intergenic
1024285018 7:47749699-47749721 CTGTCACCCCAGACAGTATTGGG - Intronic
1024706460 7:51966453-51966475 CTGTAAAAACAGAATCTATTTGG + Intergenic
1024782948 7:52873690-52873712 AATTAACCACAGAATGTGTTTGG + Intergenic
1024993198 7:55252337-55252359 CTGAGATCACTGAATGTATTTGG - Intronic
1025063097 7:55827897-55827919 GTGTAACTACAGCATATATTGGG - Intronic
1027364161 7:77440124-77440146 CTGTAATCACAAAATGTTTCAGG + Intergenic
1027838761 7:83279831-83279853 CTGTGACCACTGCATGAATTAGG + Intergenic
1028186578 7:87793328-87793350 CTGGTATCACAGAATGAATTTGG - Intronic
1031240534 7:119232616-119232638 CTGAAAACACAGAAAGTACTGGG - Intergenic
1031732275 7:125314280-125314302 CTGCTGCCAAAGAATGTATTTGG - Intergenic
1033527316 7:142229097-142229119 GTGGAACCACTGAATGTTTTAGG + Intergenic
1035456083 7:159009827-159009849 CTGTAACCAGAGGAAGAATTAGG - Intergenic
1038657431 8:29466818-29466840 CTAGAACCACAGCATCTATTTGG - Intergenic
1039250181 8:35654986-35655008 ATGAAACTACAGAATGTACTAGG + Intronic
1039757243 8:40536734-40536756 CTGACACAACAAAATGTATTTGG + Intronic
1041565519 8:59273520-59273542 CTATAAGCACAGAATGCTTTAGG - Intergenic
1043665456 8:82805636-82805658 ATGTATCCTCAGAATCTATTGGG + Intergenic
1044617143 8:94154370-94154392 CTGTCACCTGAGAATGTCTTGGG - Intronic
1045200957 8:99980709-99980731 CTGTAACCAAAGAATTTTATTGG - Intronic
1045974521 8:108116270-108116292 CTGCAACCACAGAAAGAACTAGG + Intergenic
1046137177 8:110043006-110043028 ATGTAACCTCAAAAGGTATTTGG - Intergenic
1047853835 8:128888397-128888419 CTGTAACTACAGTAGGAATTAGG + Intergenic
1049952354 9:657644-657666 CTGTAACCAGAGACTGAATTTGG - Intronic
1051640806 9:19223003-19223025 CTGCAACCTCACAATGTGTTGGG + Intergenic
1052045560 9:23790109-23790131 CTCTAACCAAAGAATGATTTAGG - Intronic
1052131446 9:24853472-24853494 CTTTAACTACAGACTTTATTGGG + Intergenic
1052615663 9:30837410-30837432 CTGAAAACAGAGAATGAATTGGG + Intergenic
1055025982 9:71721884-71721906 TTGTAATCACAAAATGCATTAGG - Intronic
1056065651 9:82931573-82931595 TTCAAACCTCAGAATGTATTTGG + Intergenic
1056466919 9:86866201-86866223 TTGTAACGACACAATTTATTTGG - Intergenic
1057974748 9:99593534-99593556 CTGTGAACACAGAAAGAATTAGG + Intergenic
1058594449 9:106600702-106600724 ATGTAACCACAGAATCAAATGGG + Intergenic
1058630145 9:106978179-106978201 CTGGAACCCCAGACTTTATTGGG - Intronic
1059117142 9:111609900-111609922 CTGAGACCACACAATGTATGTGG + Intergenic
1061339088 9:129964466-129964488 CTGTCACCCCAGAAACTATTAGG - Intronic
1203624679 Un_KI270750v1:2766-2788 CTTTAACCATAGAAGGAATTTGG - Intergenic
1187386745 X:18855914-18855936 CAGTAACCCCATAATGTATCAGG - Intergenic
1191853066 X:65600371-65600393 GTTTAACCACAGCATGGATTAGG - Intronic
1193176216 X:78397331-78397353 CTCCAAACACAGAATGTATCTGG - Intergenic
1193534304 X:82693997-82694019 CTGTAACAGCAGAAATTATTAGG - Intergenic
1196294955 X:113986642-113986664 CTGTAATTTCAGAATGAATTTGG + Intergenic
1201648535 Y:16261521-16261543 CTGCTGCCAAAGAATGTATTTGG + Intergenic
1201654275 Y:16323780-16323802 CTGCTGCCAAAGAATGTATTTGG - Intergenic