ID: 953735644

View in Genome Browser
Species Human (GRCh38)
Location 3:45491871-45491893
Sequence CAGAGTTAGCACCAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 230}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
953735644_953735650 4 Left 953735644 3:45491871-45491893 CCTCCCTCCTGGTGCTAACTCTG 0: 1
1: 0
2: 1
3: 22
4: 230
Right 953735650 3:45491898-45491920 CTTTTTCCCTGACTTCCATGAGG 0: 1
1: 0
2: 2
3: 26
4: 305
953735644_953735655 22 Left 953735644 3:45491871-45491893 CCTCCCTCCTGGTGCTAACTCTG 0: 1
1: 0
2: 1
3: 22
4: 230
Right 953735655 3:45491916-45491938 TGAGGCTGGAAAGAACACTGTGG 0: 1
1: 0
2: 2
3: 47
4: 483
953735644_953735651 8 Left 953735644 3:45491871-45491893 CCTCCCTCCTGGTGCTAACTCTG 0: 1
1: 0
2: 1
3: 22
4: 230
Right 953735651 3:45491902-45491924 TTCCCTGACTTCCATGAGGCTGG 0: 1
1: 0
2: 0
3: 19
4: 217
953735644_953735657 30 Left 953735644 3:45491871-45491893 CCTCCCTCCTGGTGCTAACTCTG 0: 1
1: 0
2: 1
3: 22
4: 230
Right 953735657 3:45491924-45491946 GAAAGAACACTGTGGGTCTTTGG 0: 1
1: 0
2: 1
3: 23
4: 215
953735644_953735656 23 Left 953735644 3:45491871-45491893 CCTCCCTCCTGGTGCTAACTCTG 0: 1
1: 0
2: 1
3: 22
4: 230
Right 953735656 3:45491917-45491939 GAGGCTGGAAAGAACACTGTGGG 0: 1
1: 0
2: 4
3: 26
4: 297

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953735644 Original CRISPR CAGAGTTAGCACCAGGAGGG AGG (reversed) Intronic
900307867 1:2019732-2019754 CAGGTTCAGCACCAGGACGGCGG - Intronic
900395363 1:2451143-2451165 CCGAGTGCGCTCCAGGAGGGAGG + Intronic
902563752 1:17296057-17296079 CAGAGTTAGCCCAAGGAGCAAGG - Intergenic
902795765 1:18799660-18799682 CACAGTTAGCTCCAGGGGGCAGG - Intergenic
902819843 1:18937154-18937176 CAGAGCAATCTCCAGGAGGGAGG + Intronic
903753118 1:25642174-25642196 CAGAGGCAGCCACAGGAGGGAGG - Intronic
905490646 1:38340872-38340894 CAGAATGAGCACCAGGAAAGAGG + Intergenic
905756019 1:40509511-40509533 GAGAGTTTGCCCCAGGAGAGAGG + Exonic
905915859 1:41683874-41683896 CAGTGATAGGACCAGGAGGGTGG - Intronic
907935571 1:59039107-59039129 CTGAGGCAGCACCAGGAGGCAGG - Intergenic
909922656 1:81401140-81401162 CAGCTTTGGCACCAGGAAGGTGG + Intronic
910259785 1:85283974-85283996 CAGAGTCGGCACCGGGAGTGGGG - Intergenic
911708433 1:101041507-101041529 GAGAATTAGTACCAGGAGTGGGG - Intergenic
912763183 1:112386631-112386653 CAGAGTGGGCACCAGGAGTGGGG - Intergenic
915144716 1:153789667-153789689 CAGAGCGAGCTCCAGGAGGGCGG - Intergenic
915930979 1:160060928-160060950 CAGAGTTCGTAGCAGGAGTGGGG + Intronic
916868597 1:168887694-168887716 AAGAGTTAGCACAGGGAGAGGGG - Intergenic
917219752 1:172716347-172716369 CAGAGTGAGCCCCTGGAGGGGGG + Intergenic
919799569 1:201345347-201345369 AAGAGTCAGCTGCAGGAGGGAGG - Intergenic
921294384 1:213688388-213688410 CAGAGATAGTTCAAGGAGGGTGG - Intergenic
923279989 1:232434452-232434474 CACAGTTAGCACCCAGAGAGAGG - Intronic
923918045 1:238530547-238530569 CAGAGTGGGCACCAGGAGCAGGG + Intergenic
924878144 1:248128451-248128473 GAGAGTTAGCAGAAGCAGGGTGG + Intergenic
1062977194 10:1692986-1693008 CAGGACTAGCACCTGGAGGGTGG - Intronic
1063017040 10:2088676-2088698 AAGAGATAGCACTAGGAGGATGG + Intergenic
1064502454 10:15989070-15989092 CAGGGTAAACACCAGGAGGCAGG + Intergenic
1065456967 10:25916992-25917014 CAAATCTAGCAGCAGGAGGGAGG - Intergenic
1067096108 10:43301371-43301393 CAGAGTGACCTCCAGGAGTGGGG + Intergenic
1070631329 10:78086823-78086845 GAGAGGTAGGACCAGGAGGTAGG - Intergenic
1070707188 10:78648245-78648267 CACAGTTAGGAACAGGAAGGTGG - Intergenic
1070727911 10:78804567-78804589 GAGAGTTTGCATCTGGAGGGAGG + Intergenic
1074126196 10:110530506-110530528 CAGAGGATGCTCCAGGAGGGCGG + Intergenic
1075625628 10:123962744-123962766 CAGAGGCAGCACCTGGAGAGAGG - Intergenic
1075643130 10:124079695-124079717 TGGAGGCAGCACCAGGAGGGAGG + Intronic
1076461215 10:130648891-130648913 CAGAGATGTCACCAGGAGGAGGG - Intergenic
1079184198 11:18221528-18221550 CAGAGTGAACACCGGGAGTGGGG + Intronic
1079883742 11:25959126-25959148 AAGATACAGCACCAGGAGGGTGG - Intergenic
1081598316 11:44474560-44474582 CAGGATTAGGACCAGGAGGATGG + Intergenic
1083665751 11:64273578-64273600 CAGAGTGAGAAGCAGGTGGGGGG + Intronic
1083882501 11:65555456-65555478 CAGTGTCTCCACCAGGAGGGAGG + Intronic
1083935039 11:65865631-65865653 CAGAGTTCCCACAGGGAGGGAGG + Intronic
1084495453 11:69500760-69500782 CAGAGGCAGGGCCAGGAGGGTGG - Intergenic
1090425107 11:126602230-126602252 CAGAGGTGGCTCCAGCAGGGAGG + Intronic
1093647349 12:21602297-21602319 CAGAGTTAGGACCAGGATTTAGG - Intronic
1093846474 12:23977822-23977844 CAGAGTTAGAACCAATAGGTGGG - Intergenic
1094168517 12:27466651-27466673 CAGAGTTAGCAAGAGAAGTGAGG + Intergenic
1098519700 12:71421261-71421283 CAGAGCAGGCACCAGGAGTGGGG + Intronic
1102576642 12:113860096-113860118 CAGAGGAGGCACCAGGAGGGGGG - Intronic
1103064452 12:117885482-117885504 CAGAGATAACCCCAGCAGGGTGG - Intronic
1103076655 12:117988632-117988654 CACAGATAGCACCAAGAGGATGG - Intergenic
1104040526 12:125127248-125127270 CAGAGTGAGCAGCAGGAAGGAGG + Intronic
1109988047 13:70016468-70016490 CATAGTTGGCACCAGGAGCAGGG - Intronic
1110810505 13:79807033-79807055 CAGAATGGCCACCAGGAGGGAGG + Intergenic
1111474267 13:88725220-88725242 CAGAGTAGGCACCAGGAGTGGGG - Intergenic
1112976701 13:105328790-105328812 CAAAGTAAGTACCAGGATGGGGG - Intergenic
1113531771 13:111032489-111032511 GAGAGTTTGCACCAGAAGTGGGG - Intergenic
1114482426 14:23044098-23044120 CAGAGGGAGCATCAGGAAGGAGG - Exonic
1114980599 14:28158518-28158540 CAGAGTGGGCACCAGGAGCAGGG + Intergenic
1116902176 14:50371857-50371879 CGGAGTGGGCACCAGGAGTGGGG - Intronic
1117068028 14:52030134-52030156 CAGATTTAGAACCAGGAAGTTGG - Intronic
1122100231 14:99402606-99402628 CAGAGTGAGACCCAGGTGGGTGG - Intronic
1122992062 14:105241126-105241148 CAGAGTCAGCCCCGGGAGGCTGG + Intronic
1123204857 14:106702464-106702486 CAGAGTGACCCCCAGGAGCGGGG - Intergenic
1123209859 14:106748905-106748927 CAGAGTGACCCCCAGGAGCGGGG - Intergenic
1125944835 15:43704414-43704436 CTGAGTTGGGAGCAGGAGGGAGG - Intergenic
1126215140 15:46146069-46146091 CAGAGTTGGCACCAGGAGTTGGG - Intergenic
1126840203 15:52710247-52710269 GAGAGTTAGCACCTGGAAGAAGG + Intergenic
1126856967 15:52848034-52848056 GAGAGTTAGCACAAGGAATGTGG + Intergenic
1128703994 15:69825337-69825359 CCCAGTAAGCACCTGGAGGGTGG + Intergenic
1129183475 15:73891659-73891681 CAGAGTGGGCACCAGGAGTGGGG - Intergenic
1131056772 15:89379471-89379493 CACACTCAGCCCCAGGAGGGCGG - Intergenic
1132101152 15:99024403-99024425 CAGAGGGAGCCCCAGGAGGATGG - Intergenic
1132753238 16:1468732-1468754 CCGCGTAAGCACCAGGAAGGGGG - Intronic
1133878880 16:9762241-9762263 CTGAGTCATCACCAGAAGGGAGG + Exonic
1135208172 16:20499885-20499907 CAAAGTGAGCACCAGGAGTGGGG - Intergenic
1135210727 16:20523815-20523837 CAAAGTGAGCACCAGGAGTGGGG + Intergenic
1137627130 16:49916307-49916329 CAGAGTGGGAACAAGGAGGGTGG - Intergenic
1138653919 16:58479350-58479372 CTCAGTGAGCACCAGGAGGATGG - Intronic
1140555458 16:75916157-75916179 AGGAGTTATCACCAGCAGGGTGG - Intergenic
1142181759 16:88674636-88674658 CAGCTTGAGCACCAGGAAGGAGG - Intergenic
1142785752 17:2221274-2221296 AGGAGATAGCACCAGGAGGATGG - Intronic
1143654039 17:8282783-8282805 CACACTAAGCACCAGGAGAGAGG - Intergenic
1144137756 17:12314618-12314640 CAGTGGCAGCAGCAGGAGGGTGG + Intergenic
1144634249 17:16893972-16893994 CAGCGCCAGCAGCAGGAGGGCGG - Intergenic
1144705287 17:17363910-17363932 CAGAGTGAGCACCTGCAGGATGG + Intergenic
1145168363 17:20633867-20633889 CAGCGCCAGCAGCAGGAGGGCGG - Intergenic
1150106730 17:62467742-62467764 CAGAGTGAGGGCCTGGAGGGTGG + Intronic
1151255667 17:72874488-72874510 CAAAGCTGACACCAGGAGGGAGG + Intronic
1151828137 17:76535057-76535079 CAGAGTTACAACCAGCAGGGAGG + Intronic
1152919197 17:83057334-83057356 TGGAGTTAGGACCCGGAGGGTGG + Intergenic
1156161553 18:34365149-34365171 GAGAGTCAGAATCAGGAGGGAGG + Intergenic
1157183626 18:45519624-45519646 CAGAGTAAGCACGAAGAAGGAGG + Intronic
1157279969 18:46340485-46340507 CAGCATAAGCCCCAGGAGGGAGG - Intronic
1157506588 18:48230874-48230896 CAGAGTGGGCACCAGGAGCAGGG - Intronic
1157797995 18:50593369-50593391 CAGAGGAAGCACCTGGAGGATGG - Intronic
1160753812 19:747608-747630 CCAAATTAGCACCAGGAGGAAGG - Exonic
1161957151 19:7502556-7502578 CAGTTTCAGCATCAGGAGGGTGG + Intronic
1163107447 19:15133423-15133445 AAAAGTTAGCACCAAGAGTGGGG + Intergenic
1163150635 19:15411282-15411304 CAGATTTAGAACAGGGAGGGGGG - Intronic
1164787009 19:30941510-30941532 CAGAGAAATCACTAGGAGGGAGG - Intergenic
1165081773 19:33311112-33311134 CAGACTCAGTTCCAGGAGGGTGG - Intergenic
1165334092 19:35156923-35156945 CAGAGGCAGGACCAGGATGGGGG + Intronic
1165490905 19:36122074-36122096 CAGAGGAAGCACCTGGAGGCTGG + Intronic
1166981632 19:46635033-46635055 CAGAGCGAGAGCCAGGAGGGGGG + Intergenic
1168309657 19:55454126-55454148 CAGGGTGAGCACCACGCGGGAGG - Intronic
1168558588 19:57364050-57364072 CAGAGTTAGAACGAGCAGGATGG + Exonic
926121306 2:10242646-10242668 CAGAGGAAGCTCCTGGAGGGAGG - Intergenic
926972656 2:18482352-18482374 CACGGTAAGCACCAGGAGGCAGG + Intergenic
929899071 2:45986005-45986027 CAAAGATAACACCATGAGGGTGG + Intronic
930381226 2:50632543-50632565 CAGAGTTTGCACCAGTAAGTTGG - Intronic
930728933 2:54709359-54709381 CAGAGTGAGCAGCAGGAGCTGGG - Intergenic
931199172 2:60080475-60080497 CAAGGTTGGCACCAGGAGTGAGG + Intergenic
932809344 2:74811178-74811200 AAGAGTTTGCATCAGGAAGGAGG + Intergenic
933466520 2:82658556-82658578 CAGAGTGTGCAACAGGGGGGTGG - Intergenic
933894588 2:86799307-86799329 CATAGTAAGGAACAGGAGGGCGG - Intronic
933966663 2:87435533-87435555 GAGAGTGAGCAGCATGAGGGTGG - Intergenic
935064642 2:99636964-99636986 CAGAGTGAGCAGCTGCAGGGTGG + Intronic
939290398 2:140187037-140187059 AAGACTTGGCACCAGGATGGTGG - Intergenic
939466326 2:142561849-142561871 CAGAGTGGGCACCAGGAGCAGGG - Intergenic
943406311 2:187492529-187492551 AAGTGTTACAACCAGGAGGGAGG + Intronic
944181831 2:196904188-196904210 CAGAGTTAGCCACTGGATGGTGG + Intronic
945395211 2:209307709-209307731 CAGAGTGGGCACCAGGAATGGGG + Intergenic
947065159 2:226216514-226216536 TAGAGAGAGCACCAGGAGTGAGG - Intergenic
948491000 2:238313497-238313519 CAAAGATGACACCAGGAGGGTGG - Intergenic
1170952089 20:20946287-20946309 CAAAGTTAGTGCCAGGAGTGGGG + Intergenic
1171037353 20:21726340-21726362 CAGAGTCACCACCAGCAGGAAGG - Intergenic
1171327733 20:24310544-24310566 CAGAGGAAGCAGCAGGAGTGTGG + Intergenic
1171392718 20:24811757-24811779 CACAGGCAGCATCAGGAGGGTGG - Intergenic
1171412212 20:24955268-24955290 CAGTGTTACCATCAGGAAGGAGG - Intronic
1172518448 20:35552118-35552140 CAAACTTAGCACCAGGAGGAAGG + Intronic
1173112169 20:40202291-40202313 AAGAGCTGGCACCAGGTGGGAGG + Intergenic
1173999287 20:47362604-47362626 CAGAGTGAGCCACAGGAGGGTGG - Intergenic
1174193570 20:48757294-48757316 CAAAGTCAGTCCCAGGAGGGTGG + Intronic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1176903162 21:14468077-14468099 TACAGCTAGCACCAGCAGGGTGG - Intergenic
1176912444 21:14582402-14582424 TAGTGTTAGCACGAGGAGGAAGG - Exonic
1177094170 21:16810950-16810972 CAAAATTAGAACCAAGAGGGAGG - Intergenic
1179519272 21:41931763-41931785 CCCAGATAGCACCAGGATGGGGG + Intronic
1180002959 21:45003325-45003347 CAGAGATTGCACCAGGCAGGGGG + Intergenic
1181669064 22:24417539-24417561 CAGAGCTACCCCCAGGAGAGCGG + Exonic
1183665800 22:39245064-39245086 CGGAGTCAGCGCCAGGAGGGGGG + Intergenic
1184032635 22:41903983-41904005 CAGAGTGGGCTCCAGGAGGCAGG - Intronic
1184657308 22:45948298-45948320 CACAGCTGGCACCTGGAGGGAGG + Intronic
950368643 3:12508081-12508103 CAGAGCTAGCATCAGTATGGAGG + Intronic
952825799 3:37523817-37523839 ATGGCTTAGCACCAGGAGGGTGG + Intronic
953735644 3:45491871-45491893 CAGAGTTAGCACCAGGAGGGAGG - Intronic
954805397 3:53216960-53216982 CAGAGGAAGCACCAGGTGGGAGG - Intergenic
954925569 3:54231298-54231320 CAGAGTGAGGACCAGAAGGCAGG - Intronic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
958699125 3:97566239-97566261 CACAGTTATCACCAAGGGGGTGG + Intronic
959279097 3:104315806-104315828 CAGAGATAGCACTAGGGGGATGG + Intergenic
961666077 3:128493783-128493805 CAGCGTTAGGAACTGGAGGGGGG - Intergenic
961714054 3:128846785-128846807 CACGGGTAGCCCCAGGAGGGCGG - Intergenic
962352366 3:134665265-134665287 CAGGGGCAGCACCAGGAGGTAGG - Intronic
962446712 3:135472428-135472450 CAGAGGTAGCATCAGGAGTTTGG - Intergenic
965529098 3:169753112-169753134 CAGAGTTAACACCAGGAAAAAGG + Intergenic
966016855 3:175150709-175150731 CAGAGTGAGCAGCAGAAGGGAGG - Intronic
966616285 3:181916714-181916736 CAGAGTTAGGAGCAGGATGGAGG - Intergenic
968584941 4:1411944-1411966 CAGAGTAACCACCAGCAGAGAGG - Intergenic
968712123 4:2126835-2126857 AAGAGGGAGCACCAGGAGAGTGG + Intronic
968779353 4:2568031-2568053 CAGAGGCAGAACCAGGAGGAAGG - Intronic
968935635 4:3608727-3608749 CAGAGTTAGCTCCAGGGCTGTGG + Intergenic
969892209 4:10270232-10270254 AAGAGTTAAGACCAGGAAGGCGG - Intergenic
974385869 4:61201582-61201604 CAGAGAAAGCAGCAGGAGGGTGG - Intronic
974686899 4:65242444-65242466 CAGAGTGGGCGCCAGGAGTGGGG + Intergenic
974697865 4:65398190-65398212 CAGAGTGGGCACCAGGAGCAGGG - Intronic
975845807 4:78524080-78524102 CAGAGTAGGAACCAGGAGGAGGG - Intronic
977770116 4:100848062-100848084 CAGAAGTAGTTCCAGGAGGGTGG - Intronic
977938010 4:102827752-102827774 CGGAGATTGGACCAGGAGGGCGG + Intronic
978313902 4:107414925-107414947 AAGAGGTACCACAAGGAGGGGGG + Intergenic
978891702 4:113836732-113836754 CTGAGTTCGCATCAGAAGGGTGG + Intergenic
979090661 4:116478397-116478419 CAGAGTGGGCATCAGGAGTGGGG + Intergenic
980568448 4:134577417-134577439 CAGAGTCAGAACCAGTAGGATGG - Intergenic
980854500 4:138423446-138423468 CAGAGTTAGCACCAAGATTTGGG + Intergenic
982097891 4:151939849-151939871 CAGAGTCAGCAGCAGCAGAGTGG - Intergenic
983952678 4:173661173-173661195 GAGAATTAGTACCAGGAGTGGGG + Intergenic
989615651 5:43334805-43334827 AAGAGGTACCACAAGGAGGGGGG - Intergenic
989987205 5:50714780-50714802 CACAGTCAGCTGCAGGAGGGAGG - Intronic
990466170 5:56073914-56073936 CAGGGTATGCACCAGGAGGCTGG + Intergenic
992174857 5:74139842-74139864 GGGACTTAGCACAAGGAGGGTGG - Intergenic
995571994 5:113490349-113490371 CAGAGTCCCCACCAGCAGGGTGG + Intergenic
998279203 5:140788413-140788435 CAGTGTGAGCACCAGCAGGCTGG - Exonic
998282397 5:140823895-140823917 CAGCGTGAGCACCAGCAGGCTGG - Exonic
998284322 5:140843444-140843466 CAGCGTGAGCACCAGCAGGCTGG - Exonic
998286917 5:140871223-140871245 CAGCGTGAGTACCAGGAGGCTGG - Exonic
998287558 5:140877595-140877617 CAGCGTGAGCACCAGCAGGCTGG - Exonic
1001034554 5:168288369-168288391 CAGACGCAGCCCCAGGAGGGTGG + Intergenic
1001854177 5:174996358-174996380 CAGATATAGAACCAGGAGAGAGG + Intergenic
1002158336 5:177300308-177300330 CAGAGATAGTACGAGGTGGGGGG + Intergenic
1002440393 5:179261600-179261622 GAGAGTTTGCACCAGGAGCAGGG + Intronic
1003571432 6:7258777-7258799 CAGAGAGGGCACCTGGAGGGTGG + Intergenic
1006189421 6:32198522-32198544 CAGAGCTGGCACGTGGAGGGTGG + Exonic
1006747758 6:36356759-36356781 CAAAGTTATTACCAGGAGGATGG + Intronic
1007599302 6:43071849-43071871 CAGAGCCGGCACCATGAGGGTGG + Exonic
1009608956 6:65912590-65912612 CAGATTTGGTACCAGGAGTGAGG + Intergenic
1011572858 6:88758678-88758700 CAGAGTTAACATCAGCAGTGAGG - Intronic
1012122302 6:95384122-95384144 CAGAGTGGGCACCGGGAGTGGGG - Intergenic
1013279572 6:108622977-108622999 CAGTGGAAGCAACAGGAGGGTGG + Intronic
1014770404 6:125453076-125453098 CAGAGCAGGCACCAGGAGTGGGG - Intergenic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015846913 6:137530527-137530549 CAGAATTAGCAAGAGGAGAGTGG - Intergenic
1016125371 6:140395763-140395785 AACAGTGAGCAGCAGGAGGGAGG - Intergenic
1018939973 6:168302623-168302645 AAGGGTTTGCAGCAGGAGGGAGG + Intronic
1018975040 6:168558163-168558185 CAAAGTGAGAACCAGGAGAGCGG + Intronic
1019160272 6:170064686-170064708 GAGTGTAGGCACCAGGAGGGTGG - Intergenic
1020950614 7:14671270-14671292 CAGAGAAAGGACCAGGAGTGAGG + Intronic
1022199146 7:28099026-28099048 CAAAGTTAGCACTAGGACTGAGG + Intronic
1023028432 7:36072753-36072775 CCGAGTAAGCACCATGAAGGAGG + Intergenic
1023798815 7:43815239-43815261 AAGAGTTACCACAAGGAGGGGGG + Intergenic
1024926347 7:54619282-54619304 CAGAGCTAGCACCAGAAAGCTGG + Intergenic
1026056785 7:66991730-66991752 CAGAGTTTGCAAAAAGAGGGCGG + Intronic
1028378966 7:90176825-90176847 CAGAGCAGGCACCAGGAGTGGGG + Intronic
1029128504 7:98312357-98312379 CTGGCTTAGCACCAGGAGTGTGG + Intronic
1029595250 7:101534163-101534185 GAGAGCCAGCACCAGGAGGCTGG + Intronic
1029655879 7:101924131-101924153 CAGAGATAGCATCAGGTGCGTGG - Intronic
1029677085 7:102077230-102077252 CAGAGAAAGCAGCAGCAGGGAGG + Intronic
1031377354 7:121043643-121043665 CAGAGTTAGGGCCAGGTGTGGGG + Intronic
1031415061 7:121485779-121485801 CAGAAGTAGCACCAAGGGGGTGG + Intergenic
1032035779 7:128520285-128520307 CAGAGTGAGGGCCTGGAGGGTGG + Intergenic
1032191359 7:129767682-129767704 CAGAGCTAGAACCAGGGTGGTGG - Intergenic
1033453869 7:141484986-141485008 CAGAGTTAGACCCAGCAGGAAGG - Intergenic
1033843619 7:145404503-145404525 CAGAGGTGGCACCGGGTGGGAGG + Intergenic
1036981857 8:13478373-13478395 CAGAGTTGGGACCTGGTGGGAGG - Intronic
1037779160 8:21855988-21856010 CAGAGGGATCACCTGGAGGGAGG - Intergenic
1037835640 8:22213410-22213432 CAGAGGAAGCAGCAGCAGGGAGG - Intergenic
1037851112 8:22329738-22329760 CAGAATTAGCACCAAGAAAGTGG - Intronic
1039796183 8:40917586-40917608 CAGAGAGAGCAACAGGAGCGTGG + Intergenic
1044114258 8:88314950-88314972 CAGCCATAGCACCAGGAAGGTGG - Intronic
1047724856 8:127675115-127675137 AAGTGTGAACACCAGGAGGGAGG + Intergenic
1048881328 8:138875081-138875103 CAGAGTTAACACCAAGACAGAGG + Intronic
1049378094 8:142298533-142298555 CTGAGTGAGCGCCAGGAGGCTGG + Intronic
1050849482 9:10265207-10265229 GAGAGTAAGCTCCAGGAGGCAGG - Intronic
1053376681 9:37612937-37612959 CAGAACTAGGACCAGTAGGGAGG + Intronic
1053577288 9:39365332-39365354 CAGAGTTCTCACCAGGAGCCTGG + Intergenic
1053841788 9:42193257-42193279 CAGAGTTCTCACCAGGAGCCTGG + Intergenic
1054098859 9:60924022-60924044 CAGAGTTCTCACCAGGAGCCTGG + Intergenic
1054120257 9:61199643-61199665 CAGAGTTCTCACCAGGAGCCTGG + Intergenic
1054454550 9:65423144-65423166 CAGAGTTAGCTCCAGGGCTGTGG - Intergenic
1054587495 9:66982911-66982933 CAGAGTTCTCACCAGGAGCCTGG - Intergenic
1059171092 9:112125880-112125902 CAGAGTTATTTCCAGGAGGGAGG + Intronic
1059877473 9:118651246-118651268 CAGAGTTAATACCAGGAAAGGGG - Intergenic
1060939816 9:127536785-127536807 CAGAGCTAGGACCAGGAGGGTGG - Intronic
1186312040 X:8331119-8331141 AAGACATAGCACAAGGAGGGAGG + Intergenic
1187464049 X:19513296-19513318 CAGAGGTGGCACCAGCAGGAAGG + Intronic
1187890726 X:23932696-23932718 AAGAGCTAGCAACAGGAGGCCGG + Intronic
1189023838 X:37370797-37370819 CAGAGTGGGTACCAGGAGTGGGG - Intronic
1189156355 X:38761212-38761234 CAGAGATAGCACAAGGTTGGTGG + Intergenic
1190113212 X:47608622-47608644 GAGAGGGAGCAACAGGAGGGAGG + Intronic
1190463152 X:50698907-50698929 CAGAGTTAGGAGGAGGAAGGTGG - Intronic
1192955446 X:76065088-76065110 CTGAGACAGCACTAGGAGGGTGG + Intergenic
1194375545 X:93128331-93128353 CAGAGTCCCCACCAGCAGGGAGG + Intergenic
1197656946 X:129126959-129126981 CAGCCTTAGCACCAAGAGGTAGG - Intergenic
1198252484 X:134893569-134893591 CAGTGTTAGCTCTAGGAGGGTGG - Intronic
1199637467 X:149826914-149826936 AAGAGGTACCACAAGGAGGGTGG + Intergenic