ID: 953736477

View in Genome Browser
Species Human (GRCh38)
Location 3:45498222-45498244
Sequence TCACTGCTGTTCACAAACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 213}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
953736477 Original CRISPR TCACTGCTGTTCACAAACTG GGG (reversed) Intronic
900484687 1:2916642-2916664 TCACACCTGTGCACACACTGTGG - Intergenic
900764398 1:4494384-4494406 TCACTGATGTTTATAACCTGAGG + Intergenic
906586365 1:46982879-46982901 TCACTGCTGTCCCCAAGATGGGG - Intergenic
908340055 1:63168916-63168938 TCACTGCTGTGCACACACAGGGG - Intergenic
910132182 1:83921277-83921299 TCTCTGCTGTTCCCAGTCTGAGG + Exonic
910887160 1:91976411-91976433 CAACTCCAGTTCACAAACTGCGG + Exonic
911666987 1:100564619-100564641 TCTCTTCTGTTCAAAAAGTGAGG - Intergenic
911747221 1:101453174-101453196 TCACTGCTGGTAACATACTTTGG + Intergenic
915564226 1:156705033-156705055 TCTCTGCAGTTCAGAAGCTGCGG - Intronic
916383530 1:164240859-164240881 ACACTAATGTTCACAAACTTTGG - Intergenic
916500208 1:165380617-165380639 TCACTGAGGTTCAGAAAGTGGGG - Intergenic
916722896 1:167498202-167498224 TCACTGCAGCTCACAGACTTCGG + Intronic
917801393 1:178573746-178573768 TCACTGCTGTTAGCACACAGTGG + Intergenic
918229846 1:182518330-182518352 GCACTGCTCTTCCCAAACGGAGG + Intronic
918912657 1:190593344-190593366 TGACTGCTGTACCCAAACTTTGG + Intergenic
920195575 1:204224011-204224033 TCACTTCTGTTCATTAAATGGGG - Intronic
922079185 1:222278209-222278231 CCACTGCTGTTCCAAGACTGAGG - Intergenic
922407683 1:225333169-225333191 CTACTGCTGTTCTCAAGCTGTGG - Intronic
922407795 1:225334660-225334682 CTACTGCTGTTCTCAAACTGTGG - Intronic
1062835034 10:629737-629759 TCACTGCTGGGCACAGCCTGAGG + Intronic
1064307780 10:14183890-14183912 TCAATACTGTTCACAAAGTTTGG - Intronic
1065544479 10:26805511-26805533 TCCCTGTTGATCACAAAGTGTGG - Intronic
1066471463 10:35701947-35701969 GCTCTGCTGCTCACTAACTGAGG - Intergenic
1068054320 10:51992237-51992259 ACACTTCTGTTCACAAAATTGGG - Intronic
1074070038 10:110058337-110058359 TCCCAGCTGTTGATAAACTGTGG + Intronic
1074591297 10:114816307-114816329 TCACTGCAGATCACAGAGTGAGG + Intergenic
1075832099 10:125420072-125420094 TCACTTCTGTTCTCCCACTGAGG + Intergenic
1077477245 11:2796344-2796366 TCACGGCTCCTCCCAAACTGAGG + Intronic
1079182939 11:18209470-18209492 TCCCCGCTTTTCACAGACTGGGG + Exonic
1082837283 11:57660536-57660558 TCCCAGCTGTTCAGAGACTGAGG + Intronic
1084860882 11:72017432-72017454 TCTCTGCTGTTCACAAGATGTGG - Intronic
1086577681 11:88359269-88359291 ACACTGCTATTTACAAGCTGTGG - Intergenic
1089819032 11:121205073-121205095 AGACAGCAGTTCACAAACTGAGG - Intergenic
1090113622 11:123942888-123942910 TCACTGCTGTGATGAAACTGAGG - Exonic
1091155047 11:133364138-133364160 GGACTGCTGTTTACAAACAGAGG - Intronic
1095657609 12:44688582-44688604 CCTCTGCTGTTTACTAACTGTGG - Intronic
1096657486 12:53100762-53100784 TCTCTGCGGTTCACATCCTGTGG - Exonic
1099363636 12:81740519-81740541 ACTCTCCTTTTCACAAACTGAGG + Intronic
1100406229 12:94275059-94275081 TCTCTGCTGCTCACCAGCTGAGG - Intronic
1103259675 12:119575679-119575701 ACTCTGCTGTTCTCAAACTTGGG + Intergenic
1104042849 12:125141775-125141797 GCACGGCTGTTGAGAAACTGAGG - Intronic
1105205921 13:18223948-18223970 TCACTGAGGTTATCAAACTGCGG + Intergenic
1105617529 13:22032872-22032894 TCACTGCTATTTACAATTTGTGG + Intergenic
1106192459 13:27465712-27465734 TCACTGCTGTCCAGAGTCTGAGG + Intergenic
1106625154 13:31413034-31413056 TCTCTGATGTTCAAAAGCTGAGG + Intergenic
1106777841 13:33025823-33025845 TCACAGCAATTCACAAGCTGGGG - Intronic
1107790297 13:43995227-43995249 TCACTGCTGGTAACATACTTTGG - Intergenic
1107988084 13:45793123-45793145 ACACTGTTGCTCACAATCTGAGG - Intronic
1109771482 13:66980208-66980230 TTACTCATGTTCCCAAACTGGGG + Intronic
1110329012 13:74250057-74250079 TCACTCCTCTTCCCAAAATGAGG - Intergenic
1111836261 13:93392183-93392205 ACACTGCTATTCAATAACTGAGG + Intronic
1111926481 13:94468799-94468821 ACACTGCAGTTGGCAAACTGCGG + Exonic
1112161698 13:96874771-96874793 GCTCTGCTCTTCACAAACTCAGG - Intergenic
1112550424 13:100415446-100415468 TGACTGTTCTGCACAAACTGTGG - Intronic
1113220832 13:108099984-108100006 TCACTTATGTTAACAAAATGTGG + Intergenic
1115469864 14:33757365-33757387 TCACTGCTGTTCAACATATGGGG + Intronic
1117279872 14:54228740-54228762 TGTAGGCTGTTCACAAACTGGGG - Intergenic
1117644315 14:57835293-57835315 TCCTTGCAGTTCACAAGCTGTGG + Intronic
1117844929 14:59900888-59900910 TCACTGCTGCTTACAGGCTGGGG - Intergenic
1117861243 14:60094673-60094695 CCACTGCCGTTCACAGGCTGGGG - Intronic
1119636592 14:76278319-76278341 CCACTGCTGTTGACATGCTGGGG + Intergenic
1120222591 14:81751349-81751371 AAACAGTTGTTCACAAACTGTGG + Intergenic
1120892591 14:89504505-89504527 GCACAGCTCTACACAAACTGGGG - Intronic
1125956630 15:43794980-43795002 TAAGTCCTTTTCACAAACTGGGG - Exonic
1125983562 15:44027080-44027102 CCATGGTTGTTCACAAACTGTGG + Intronic
1128084231 15:64874908-64874930 ACACTGCTGTGCATAAGCTGTGG + Intronic
1130000543 15:80042933-80042955 TCAGTGCTGGGCTCAAACTGTGG - Intergenic
1130153711 15:81332183-81332205 TCACTGCTGGTGACATACTTTGG + Exonic
1130642302 15:85689638-85689660 TCACTGCATTTTACAAAATGAGG + Intronic
1131805154 15:96114526-96114548 TTAATGCTGTCCACAAATTGAGG - Intergenic
1131955594 15:97731977-97731999 TCACTGCTATTCACATAATAAGG - Intergenic
1133942161 16:10318367-10318389 TCACTGCTTTTCTCTAACTCTGG + Intergenic
1134436606 16:14264683-14264705 TCAGTGCTGTTTAGAAACAGTGG + Exonic
1135435807 16:22425909-22425931 TCACTGCTGCTCTCCAAGTGAGG - Intronic
1135861610 16:26060910-26060932 TCACTGTTATCCACATACTGAGG + Intronic
1139095006 16:63694810-63694832 TCACTGTTGTCCACAATATGTGG + Intergenic
1139925671 16:70484689-70484711 TCCCTGCTGTTCTTAAACTCTGG - Intronic
1141866746 16:86755576-86755598 TCACTGCCGCTCACCAACAGAGG + Intergenic
1142045019 16:87919739-87919761 TCACTGCTGCTCTCCAAGTGAGG - Intronic
1148722276 17:49762955-49762977 TCAGTGCTGTTCAGAAAGTGGGG + Intronic
1149308422 17:55371503-55371525 TCACTGCTGTCCACAAGCCCAGG + Intergenic
1149314394 17:55424859-55424881 TCACTGATGTTTCCAAACTTAGG - Intergenic
1150758969 17:67943005-67943027 CCACTGAGGTTCACAAACTCAGG - Intronic
1150859520 17:68786926-68786948 TCACTGCGCTTCACACACTGGGG - Intergenic
1150859630 17:68787812-68787834 TCAGTGCATTTCACACACTGGGG + Intergenic
1151087668 17:71399170-71399192 TCCCTGCTGTTTAACAACTGTGG + Intergenic
1151549897 17:74816276-74816298 TCACAGATGACCACAAACTGGGG - Intronic
1154470115 18:14692778-14692800 ACACTGCTGCTCCCAAGCTGGGG - Intergenic
1155708636 18:28847706-28847728 CCACTGCCGTCCACCAACTGAGG + Intergenic
1155839044 18:30625326-30625348 ACACAGCTGTTCACAAACAGAGG - Intergenic
1156773317 18:40756905-40756927 TTAGTGCTGTTCCCAATCTGTGG - Intergenic
1157112162 18:44831645-44831667 TCACTCCTCTTCATAACCTGAGG - Intronic
1158112515 18:53956395-53956417 TCACTGCTTTTCACAACCAATGG + Intergenic
1159245462 18:65799355-65799377 TCACTCCTGTTGACTCACTGGGG - Intronic
1159466784 18:68794184-68794206 TTACTGCTGTTCTCAATGTGTGG + Intronic
1162606259 19:11710447-11710469 TCCCTTCTGCTCACACACTGAGG + Intergenic
1162742037 19:12778872-12778894 TCACTGCTTTTCCCCAAATGTGG - Intronic
1165285310 19:34837393-34837415 TCACTGCTGCTTACAGGCTGGGG + Intergenic
1166213413 19:41321356-41321378 TCACTGCTGTTCCCAAGCCAGGG + Intronic
1168016519 19:53578000-53578022 TGACTGCAGGTAACAAACTGTGG - Exonic
1168516697 19:57015205-57015227 TCACTCCTCTTCAGACACTGTGG + Intergenic
924974341 2:159344-159366 TCTCTGCCGTTTACAAACTTGGG + Intergenic
925840888 2:7990627-7990649 TCTCTGCAGTTCACTACCTGGGG + Intergenic
927092864 2:19725756-19725778 TCAGTGACGTTTACAAACTGAGG - Intergenic
929250216 2:39745938-39745960 GCTCTGCTGCTCACTAACTGTGG + Intronic
929869441 2:45745760-45745782 TCACCACTGTTCAGATACTGAGG - Intronic
930175310 2:48295294-48295316 TCTGTTCTGTTCACAAATTGGGG + Intergenic
930697156 2:54423425-54423447 TGACTGCTGTTCAGAAGCTCGGG - Intergenic
931753629 2:65352359-65352381 TCACTGATGTTAAATAACTGTGG - Intronic
932484534 2:72075635-72075657 TCACTGCTGCTCACATTCTATGG - Intergenic
938087878 2:128413239-128413261 TCCCTGCTGCTCAGGAACTGAGG + Intergenic
938870660 2:135472522-135472544 TCACAGATGTTCACAAGCTTGGG + Intronic
939929795 2:148218581-148218603 TCTATGCTGTTCACACAATGAGG - Intronic
940838378 2:158550722-158550744 TCACTCAAGTTCTCAAACTGTGG + Intronic
942518205 2:176775345-176775367 TAACTGCTGATCACAAAGTCAGG + Intergenic
943369014 2:186992721-186992743 TCAAAGCTAATCACAAACTGGGG - Intergenic
945818229 2:214631727-214631749 TCACTTCTGTCAACAAAATGCGG + Intergenic
948671739 2:239573093-239573115 CAACTGCTCTTCACAAGCTGAGG - Intergenic
1172824783 20:37772206-37772228 TCCCAGCTGTTCTCAAACTGTGG + Intronic
1173292436 20:41726710-41726732 TCACTCCTGGTCCCAAATTGGGG + Intergenic
1179067143 21:38036158-38036180 TGACTGCTGTCCTCATACTGAGG + Intronic
1179934836 21:44596160-44596182 TGACAGCTGGTGACAAACTGAGG - Intronic
1180723198 22:17924780-17924802 TACCTGCTGTTCTCACACTGTGG - Intronic
1181071628 22:20345943-20345965 TCACTGAGGTTATCAAACTGCGG + Intergenic
1181194698 22:21174885-21174907 TCACTGAGGTTATCAAACTGCGG + Intergenic
1181214746 22:21317885-21317907 TCACTGAGGTTATCAAACTGCGG - Intergenic
1182597162 22:31430832-31430854 TCTCAGCTATTCAGAAACTGAGG - Intronic
953736477 3:45498222-45498244 TCACTGCTGTTCACAAACTGGGG - Intronic
955191320 3:56764374-56764396 TCACTGCTGTTCACCTTCTGTGG - Intronic
955455141 3:59112008-59112030 TAAGTGCTGTTCTCAAACTGAGG + Intergenic
956080464 3:65550754-65550776 TCAAAGCTGGTCACAAACTTCGG - Intronic
958030418 3:88102558-88102580 TCACTGGGATTCACAAACTATGG + Intronic
958259309 3:91361166-91361188 ACACTGGAGTTAACAAACTGGGG + Intergenic
959401305 3:105905299-105905321 TCACTGCTGCTAACATACTTTGG + Intergenic
961295605 3:125881781-125881803 TCACTGCAGTGCAAAGACTGAGG - Intergenic
961716860 3:128863793-128863815 TCAGTGCTGGGCACAAAATGGGG - Intergenic
964803559 3:160581313-160581335 GCACTGCCCTTCCCAAACTGGGG - Intergenic
964845853 3:161043401-161043423 TCAATTTTGTTCACATACTGCGG + Intronic
967048195 3:185756665-185756687 TCTCTGCTGATCAGAAACTCAGG + Intronic
968970140 4:3789517-3789539 TCACAGATGATCACAAACTGGGG - Intergenic
968991982 4:3920335-3920357 TCTTGGCTGTTCTCAAACTGTGG + Intergenic
969102052 4:4776732-4776754 TCACTGGTGTACACAGACAGGGG - Intergenic
972693807 4:41425072-41425094 TCATTGCTTTTAACAACCTGGGG + Intronic
972986496 4:44772314-44772336 TCACTGCTGCTGACATACTTTGG + Intergenic
974359713 4:60861360-60861382 TCCCTGCTGTACTCAAACTCTGG - Intergenic
974530836 4:63106236-63106258 CCACTGCTGCTTACAAGCTGGGG - Intergenic
975404084 4:73969117-73969139 TCTCTTCTGTTCACAGGCTGGGG + Intergenic
975733514 4:77359735-77359757 GCACTGCTGTTCACCAGCTCAGG + Intronic
976934099 4:90607191-90607213 TCACTGCCTTTCAAATACTGAGG - Intronic
977020720 4:91755749-91755771 TCTCTGCAGTTCACCAAGTGAGG + Intergenic
977998557 4:103527611-103527633 TCACTACAGTTAAGAAACTGAGG + Intergenic
979387299 4:120082598-120082620 TTACTTCAGTTCACAAAGTGTGG - Intergenic
984445229 4:179828388-179828410 TAACTGCTACTCTCAAACTGGGG + Intergenic
984585195 4:181555825-181555847 TCACTTCTGCTCACATACTATGG + Intergenic
985149879 4:186935919-186935941 ACACTGCTGGGCACAGACTGAGG + Intergenic
986290452 5:6395328-6395350 TCACTGCAGGTGACAAACAGAGG - Intergenic
987655018 5:20796274-20796296 TCACTGCTGGTAACATACTTTGG + Intergenic
987758342 5:22125767-22125789 TCAATGGTGTTCTTAAACTGAGG - Intronic
988152136 5:27397767-27397789 TCTCTACCATTCACAAACTGTGG + Intergenic
990175604 5:53104554-53104576 TCAATGCTATTTAGAAACTGTGG - Intronic
990488476 5:56281373-56281395 TGACTGCCATTCACTAACTGAGG - Intergenic
991685814 5:69181500-69181522 TCCATGCTGTGCTCAAACTGTGG + Intergenic
991749099 5:69779905-69779927 TCATTGGTGTTCTTAAACTGAGG - Intergenic
991800680 5:70359716-70359738 TCATTGGTGTTCTTAAACTGAGG - Intergenic
991827920 5:70650325-70650347 TCATTGGTGTTCTTAAACTGAGG + Intergenic
991893039 5:71359156-71359178 TCATTGGTGTTCTTAAACTGAGG - Intergenic
996353436 5:122571358-122571380 TAACTGCTGTTCAATAAATGAGG - Intergenic
999282188 5:150373248-150373270 TCACTGTGTTTCACAAGCTGTGG + Intronic
1001441381 5:171745795-171745817 TGACTGCTGCTCACCATCTGTGG - Intergenic
1001831308 5:174791432-174791454 TCCCTGCTCTTCTCAATCTGAGG - Intergenic
1002217105 5:177645044-177645066 TCACTTCTTATCAGAAACTGTGG - Intergenic
1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG + Intronic
1003456398 6:6286595-6286617 TCACTGCTGCTAACATACTTTGG + Intronic
1005027811 6:21480401-21480423 TTACTGCTTCTCACATACTGTGG + Intergenic
1005628206 6:27683658-27683680 TCTCTTCTTTTCAGAAACTGTGG + Intergenic
1006600094 6:35219572-35219594 TCACTGGTGGTAACAAGCTGAGG + Intronic
1007290111 6:40779287-40779309 TCCCAGGTGTTCAAAAACTGAGG + Intergenic
1008995931 6:57659160-57659182 ACACTGGAGTTAACAAACTGGGG - Intergenic
1009184457 6:60557939-60557961 ACACTGGAGTTAACAAACTGGGG - Intergenic
1013176551 6:107682665-107682687 TCACAGGTGTTCACAAGGTGAGG - Intergenic
1017724499 6:157267675-157267697 TCCCTGCAGCTCACAGACTGGGG - Intergenic
1020471123 7:8536280-8536302 TCAATGCTGATCACATATTGAGG + Intronic
1021219974 7:17964252-17964274 TCACTGCAGGTAAAAAACTGAGG - Intergenic
1021721930 7:23513022-23513044 TCTCTGTTGTGTACAAACTGAGG + Exonic
1021923095 7:25506434-25506456 TCTCTTCTTTTCACAAACAGAGG - Intergenic
1023247322 7:38219084-38219106 CCACTGCACTTCACAAAGTGAGG - Intronic
1023907692 7:44533851-44533873 TCCCTGCTGTTCCCACACAGAGG - Exonic
1024365523 7:48516093-48516115 TCATTTCTGTTCACCAAGTGAGG + Intronic
1024673816 7:51620397-51620419 TCACTACTTTTCTCAAACAGTGG - Intergenic
1024937898 7:54730343-54730365 TTTCTGTTGTTCACCAACTGAGG + Intergenic
1027487806 7:78783741-78783763 GCACTGCTGTCTACAAACTGGGG - Intronic
1028094391 7:86742261-86742283 TCGCTGCTTTTGACAACCTGGGG + Intronic
1028473968 7:91233966-91233988 TCATCGCACTTCACAAACTGAGG + Intergenic
1029557846 7:101282763-101282785 CCACTGCTGTCCAAAAACAGAGG + Intergenic
1032717135 7:134518968-134518990 TGACTGCTGCTCACCAACTTTGG - Intergenic
1036713074 8:11094613-11094635 CCACTGCAGTGCACAGACTGGGG + Intronic
1037304384 8:17490018-17490040 TCACTGCTGTTGACACACAAAGG + Intergenic
1040414572 8:47184747-47184769 TCACTGCTGGTCACTGAGTGAGG - Intergenic
1041106770 8:54452756-54452778 TCTCTTCTGTTCAGAAACTTTGG + Intergenic
1042876902 8:73448633-73448655 TCACAGTTGCTCAGAAACTGGGG + Intronic
1047544611 8:125803596-125803618 TCACTGCTGCTAACATACTTCGG - Intergenic
1047882337 8:129209902-129209924 TTACTGCAGTACACAACCTGTGG + Intergenic
1049050097 8:140187939-140187961 TCACTGCTTTTAAGAACCTGTGG - Intronic
1049113444 8:140664808-140664830 TCTCTGCTGGCCACAGACTGAGG + Intronic
1050583936 9:7090358-7090380 TCCCTGCTGATAACAAGCTGTGG - Intergenic
1053524098 9:38811255-38811277 GTACTGCTGTTCAGAAACGGAGG + Intergenic
1054196330 9:62035664-62035686 GTACTGCTGTTCAGAAACGGAGG + Intergenic
1054642076 9:67553023-67553045 GTACTGCTGTTCAGAAACGGAGG - Intergenic
1056844692 9:90027036-90027058 TGACTTCTGTTCACAAACATTGG - Intergenic
1056872151 9:90291913-90291935 TCTCTGGTGTTCACAAAGTGAGG + Intergenic
1058009077 9:99955608-99955630 TCATTGCTGTTCATAAAGTATGG + Intronic
1058417132 9:104800988-104801010 TCACTGCTGTCCACAATCCTAGG + Intronic
1059008119 9:110426501-110426523 ACTCTGTTGTTCACTAACTGTGG - Intronic
1059488224 9:114643871-114643893 CCACTGCTTTTCACAAAATATGG - Exonic
1060364540 9:122997204-122997226 TAACTGTTGTTCACTCACTGTGG + Intronic
1062715400 9:138007724-138007746 TCACAGCAGTTCTCAAAGTGGGG - Intronic
1186570761 X:10712688-10712710 TCACTTCTGCTCTCAAAATGTGG + Intronic
1188182731 X:27075561-27075583 ACACTGCTGTCCACAGACAGAGG + Intergenic
1189645563 X:43125792-43125814 TTACTGCTGACCAAAAACTGAGG - Intergenic
1190047569 X:47124946-47124968 TCACTGATCTTCCAAAACTGTGG + Intergenic
1194575260 X:95605360-95605382 TCTCTGCTGTTCAGTTACTGAGG - Intergenic
1194819315 X:98486597-98486619 ACACAGCAGTTCTCAAACTGTGG - Intergenic
1195698146 X:107682068-107682090 TCACTGCTCTCCCCACACTGAGG - Intergenic
1199466934 X:148148631-148148653 TGAGTTCTGTTAACAAACTGAGG + Intergenic
1199872330 X:151911318-151911340 TCACTGCACTGCACAATCTGAGG + Intergenic
1199949604 X:152697889-152697911 TCACTTCTTTGCACAATCTGAGG + Intergenic
1199960071 X:152770572-152770594 TCACTTCTTTGCACAATCTGAGG - Intergenic